Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637861_at:

>probe:Drosophila_2:1637861_at:512:107; Interrogation_Position=131; Antisense; AGAATCTTCGGCTAACCGGTCTGGG
>probe:Drosophila_2:1637861_at:642:41; Interrogation_Position=169; Antisense; ATCGGTGCCAAGAGATCGTCGGAAA
>probe:Drosophila_2:1637861_at:53:637; Interrogation_Position=206; Antisense; TCGAGTATATCGCACCACCAAGTCA
>probe:Drosophila_2:1637861_at:151:565; Interrogation_Position=246; Antisense; GGAATTTCCGCTGATGGAGCTCAAT
>probe:Drosophila_2:1637861_at:424:553; Interrogation_Position=261; Antisense; GGAGCTCAATCGTGTGGGCGTAATT
>probe:Drosophila_2:1637861_at:96:89; Interrogation_Position=29; Antisense; AGTCGCCCATTTTGGATGTCACCGA
>probe:Drosophila_2:1637861_at:221:485; Interrogation_Position=293; Antisense; GTATGTTTCCGGGTTTTGTGCACCG
>probe:Drosophila_2:1637861_at:526:611; Interrogation_Position=330; Antisense; TGAAAAGCGACCCATTCCGGAGGCT
>probe:Drosophila_2:1637861_at:698:309; Interrogation_Position=365; Antisense; CCAAGTACTTTGAGCGGCGCAAGCG
>probe:Drosophila_2:1637861_at:430:61; Interrogation_Position=44; Antisense; ATGTCACCGAGACCGTATCGATGCA
>probe:Drosophila_2:1637861_at:172:677; Interrogation_Position=441; Antisense; TAGGATAGCATTCCGAGCAGCGCTG
>probe:Drosophila_2:1637861_at:100:289; Interrogation_Position=502; Antisense; CTGGCGCTGCGGGATGAACTGCAAA
>probe:Drosophila_2:1637861_at:595:187; Interrogation_Position=552; Antisense; AACAGCCGGCGGCATGTTGTCCATG
>probe:Drosophila_2:1637861_at:688:549; Interrogation_Position=90; Antisense; GGAGTCCAAGAACAATCCGTCCTAC

Paste this into a BLAST search page for me
AGAATCTTCGGCTAACCGGTCTGGGATCGGTGCCAAGAGATCGTCGGAAATCGAGTATATCGCACCACCAAGTCAGGAATTTCCGCTGATGGAGCTCAATGGAGCTCAATCGTGTGGGCGTAATTAGTCGCCCATTTTGGATGTCACCGAGTATGTTTCCGGGTTTTGTGCACCGTGAAAAGCGACCCATTCCGGAGGCTCCAAGTACTTTGAGCGGCGCAAGCGATGTCACCGAGACCGTATCGATGCATAGGATAGCATTCCGAGCAGCGCTGCTGGCGCTGCGGGATGAACTGCAAAAACAGCCGGCGGCATGTTGTCCATGGGAGTCCAAGAACAATCCGTCCTAC

Full Affymetrix probeset data:

Annotations for 1637861_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime