Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637866_at:

>probe:Drosophila_2:1637866_at:606:215; Interrogation_Position=1857; Antisense; AAGATTCAGGAGAGTGCCCGCTTCA
>probe:Drosophila_2:1637866_at:369:625; Interrogation_Position=1871; Antisense; TGCCCGCTTCATAGAGCAGCAACGT
>probe:Drosophila_2:1637866_at:654:139; Interrogation_Position=1892; Antisense; ACGTGGCAAGAGCAGTGTCACTTTT
>probe:Drosophila_2:1637866_at:545:593; Interrogation_Position=1947; Antisense; TGGGAGCAGCAACTCCGTCTTAAGC
>probe:Drosophila_2:1637866_at:157:711; Interrogation_Position=1966; Antisense; TTAAGCGCACTCCACTAGACGTCTA
>probe:Drosophila_2:1637866_at:243:147; Interrogation_Position=1979; Antisense; ACTAGACGTCTACTATGCCAGCTGG
>probe:Drosophila_2:1637866_at:235:627; Interrogation_Position=1994; Antisense; TGCCAGCTGGCTAAAGACACACGAG
>probe:Drosophila_2:1637866_at:694:409; Interrogation_Position=2029; Antisense; GACGACAGGCAGCACATACAGATGA
>probe:Drosophila_2:1637866_at:653:653; Interrogation_Position=2056; Antisense; TCAATGCGGACTATGATGTGCCCAA
>probe:Drosophila_2:1637866_at:257:613; Interrogation_Position=2123; Antisense; TGAAAACGGCGAGGTCGAACTCTTC
>probe:Drosophila_2:1637866_at:717:715; Interrogation_Position=2145; Antisense; TTCCCCTCGGACTCGGAAGATGAAG
>probe:Drosophila_2:1637866_at:555:607; Interrogation_Position=2174; Antisense; TGATGGCCTGCATTTGGGATCAGAT
>probe:Drosophila_2:1637866_at:664:561; Interrogation_Position=2237; Antisense; GGAAGTTGAGCACCCTAAAGCCAAA
>probe:Drosophila_2:1637866_at:590:179; Interrogation_Position=2291; Antisense; AAAACCTCGGCCAGCAACAGTGGAA

Paste this into a BLAST search page for me
AAGATTCAGGAGAGTGCCCGCTTCATGCCCGCTTCATAGAGCAGCAACGTACGTGGCAAGAGCAGTGTCACTTTTTGGGAGCAGCAACTCCGTCTTAAGCTTAAGCGCACTCCACTAGACGTCTAACTAGACGTCTACTATGCCAGCTGGTGCCAGCTGGCTAAAGACACACGAGGACGACAGGCAGCACATACAGATGATCAATGCGGACTATGATGTGCCCAATGAAAACGGCGAGGTCGAACTCTTCTTCCCCTCGGACTCGGAAGATGAAGTGATGGCCTGCATTTGGGATCAGATGGAAGTTGAGCACCCTAAAGCCAAAAAAACCTCGGCCAGCAACAGTGGAA

Full Affymetrix probeset data:

Annotations for 1637866_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime