FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637867_at:

>probe:Drosophila_2:1637867_at:12:223; Interrogation_Position=2344; Antisense; AAGGTTAGCCATCTTTTTGAATGTT
>probe:Drosophila_2:1637867_at:361:315; Interrogation_Position=2351; Antisense; GCCATCTTTTTGAATGTTGTAAATT
>probe:Drosophila_2:1637867_at:441:205; Interrogation_Position=2444; Antisense; AAGCTGTACAGTTCTTCTCACTTTC
>probe:Drosophila_2:1637867_at:673:275; Interrogation_Position=2460; Antisense; CTCACTTTCCCCTAGACAATTTTTG
>probe:Drosophila_2:1637867_at:650:31; Interrogation_Position=2487; Antisense; ATCTAGTTTAACTTATTGTACAAAT
>probe:Drosophila_2:1637867_at:427:467; Interrogation_Position=2520; Antisense; GTTGTTCGAAAACTCATCTCAGTGT
>probe:Drosophila_2:1637867_at:675:143; Interrogation_Position=2531; Antisense; ACTCATCTCAGTGTAAAGTTAGAAC
>probe:Drosophila_2:1637867_at:114:381; Interrogation_Position=2552; Antisense; GAACGAAATTCACTCAAAAACTAAG
>probe:Drosophila_2:1637867_at:727:239; Interrogation_Position=2604; Antisense; AATAAAACGCTGCACGATTGTAAAC
>probe:Drosophila_2:1637867_at:224:201; Interrogation_Position=2609; Antisense; AACGCTGCACGATTGTAAACTATAT
>probe:Drosophila_2:1637867_at:271:599; Interrogation_Position=2641; Antisense; TGTAGTGTAAGCATAAATCGTTAGT
>probe:Drosophila_2:1637867_at:400:189; Interrogation_Position=2701; Antisense; AACAGTAAATTCATAGACGCTTCAG
>probe:Drosophila_2:1637867_at:83:13; Interrogation_Position=2709; Antisense; ATTCATAGACGCTTCAGTTAGTTAT
>probe:Drosophila_2:1637867_at:269:257; Interrogation_Position=2723; Antisense; CAGTTAGTTATATTTATCCGGCGAA

Paste this into a BLAST search page for me
AAGGTTAGCCATCTTTTTGAATGTTGCCATCTTTTTGAATGTTGTAAATTAAGCTGTACAGTTCTTCTCACTTTCCTCACTTTCCCCTAGACAATTTTTGATCTAGTTTAACTTATTGTACAAATGTTGTTCGAAAACTCATCTCAGTGTACTCATCTCAGTGTAAAGTTAGAACGAACGAAATTCACTCAAAAACTAAGAATAAAACGCTGCACGATTGTAAACAACGCTGCACGATTGTAAACTATATTGTAGTGTAAGCATAAATCGTTAGTAACAGTAAATTCATAGACGCTTCAGATTCATAGACGCTTCAGTTAGTTATCAGTTAGTTATATTTATCCGGCGAA

Full Affymetrix probeset data:

Annotations for 1637867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720