FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637869_at:

>probe:Drosophila_2:1637869_at:485:9; Interrogation_Position=2493; Antisense; ATTCCATACTGCCATTTTCACAATT
>probe:Drosophila_2:1637869_at:643:659; Interrogation_Position=2517; Antisense; TAACGAACTTTACCAGTGTTTCACT
>probe:Drosophila_2:1637869_at:424:231; Interrogation_Position=2564; Antisense; AATGTTTTTTATATGCGCATCTGTA
>probe:Drosophila_2:1637869_at:116:491; Interrogation_Position=2616; Antisense; GTACACACGATTCATTTCGACACAT
>probe:Drosophila_2:1637869_at:391:491; Interrogation_Position=2648; Antisense; GTGATAAAACCGAGCGTATTCTGTA
>probe:Drosophila_2:1637869_at:522:601; Interrogation_Position=2742; Antisense; TGTATATTTGGCCAATGCGATTCAA
>probe:Drosophila_2:1637869_at:220:463; Interrogation_Position=2760; Antisense; GATTCAAAATTGAGCAGCCGCTGTT
>probe:Drosophila_2:1637869_at:132:421; Interrogation_Position=2771; Antisense; GAGCAGCCGCTGTTTGAGAATTTAA
>probe:Drosophila_2:1637869_at:657:569; Interrogation_Position=2826; Antisense; GGCATAGATTTCCAAGACACATACA
>probe:Drosophila_2:1637869_at:186:473; Interrogation_Position=2899; Antisense; GTTCAAACCCAAAACCAGCAGAAGT
>probe:Drosophila_2:1637869_at:153:369; Interrogation_Position=2936; Antisense; GAATGAAACCCAACTAGGAGCCCAA
>probe:Drosophila_2:1637869_at:148:251; Interrogation_Position=2946; Antisense; CAACTAGGAGCCCAAACGATTTTCG
>probe:Drosophila_2:1637869_at:57:473; Interrogation_Position=2971; Antisense; GTTCTCCCCTCGAATCAATAACAGA
>probe:Drosophila_2:1637869_at:95:151; Interrogation_Position=2996; Antisense; ACTTGGCATTTTCACGTATCCTTAA

Paste this into a BLAST search page for me
ATTCCATACTGCCATTTTCACAATTTAACGAACTTTACCAGTGTTTCACTAATGTTTTTTATATGCGCATCTGTAGTACACACGATTCATTTCGACACATGTGATAAAACCGAGCGTATTCTGTATGTATATTTGGCCAATGCGATTCAAGATTCAAAATTGAGCAGCCGCTGTTGAGCAGCCGCTGTTTGAGAATTTAAGGCATAGATTTCCAAGACACATACAGTTCAAACCCAAAACCAGCAGAAGTGAATGAAACCCAACTAGGAGCCCAACAACTAGGAGCCCAAACGATTTTCGGTTCTCCCCTCGAATCAATAACAGAACTTGGCATTTTCACGTATCCTTAA

Full Affymetrix probeset data:

Annotations for 1637869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720