FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637871_at:

>probe:Drosophila_2:1637871_at:709:721; Interrogation_Position=1544; Antisense; TTGCAACCCTTGTACCGTCGAGGAG
>probe:Drosophila_2:1637871_at:318:551; Interrogation_Position=1568; Antisense; GGAGATGTCCATGCCAACCAGAGAG
>probe:Drosophila_2:1637871_at:402:253; Interrogation_Position=1582; Antisense; CAACCAGAGAGCTTATCGAACGCCA
>probe:Drosophila_2:1637871_at:688:593; Interrogation_Position=1629; Antisense; TGGGACAATCTACTGGCCATCATTC
>probe:Drosophila_2:1637871_at:111:75; Interrogation_Position=1684; Antisense; AGGAGCACGCCTCGAGTGCGATTCA
>probe:Drosophila_2:1637871_at:727:507; Interrogation_Position=1699; Antisense; GTGCGATTCACGACTACGATGGGCT
>probe:Drosophila_2:1637871_at:495:67; Interrogation_Position=1725; Antisense; ATGGCAGTGCGTTCGTCCATGGGAA
>probe:Drosophila_2:1637871_at:351:637; Interrogation_Position=1737; Antisense; TCGTCCATGGGAACGGGTGCCTTAA
>probe:Drosophila_2:1637871_at:44:33; Interrogation_Position=1788; Antisense; ATCAAGGCCATTGCCCGATTATCGG
>probe:Drosophila_2:1637871_at:573:325; Interrogation_Position=1855; Antisense; GCGAGGGTCTCCACTGGGTGAACAT
>probe:Drosophila_2:1637871_at:404:451; Interrogation_Position=1952; Antisense; GATCGAGGGACATACCATTTGTGCC
>probe:Drosophila_2:1637871_at:692:189; Interrogation_Position=2019; Antisense; AACTTCCGACCGGTCATCGAGGAGA
>probe:Drosophila_2:1637871_at:447:335; Interrogation_Position=2079; Antisense; GCTGAAGCACTCGAAGCCGAACGTT
>probe:Drosophila_2:1637871_at:541:177; Interrogation_Position=2113; Antisense; AAACGGTGACTCCTTGTCCAGAATA

Paste this into a BLAST search page for me
TTGCAACCCTTGTACCGTCGAGGAGGGAGATGTCCATGCCAACCAGAGAGCAACCAGAGAGCTTATCGAACGCCATGGGACAATCTACTGGCCATCATTCAGGAGCACGCCTCGAGTGCGATTCAGTGCGATTCACGACTACGATGGGCTATGGCAGTGCGTTCGTCCATGGGAATCGTCCATGGGAACGGGTGCCTTAAATCAAGGCCATTGCCCGATTATCGGGCGAGGGTCTCCACTGGGTGAACATGATCGAGGGACATACCATTTGTGCCAACTTCCGACCGGTCATCGAGGAGAGCTGAAGCACTCGAAGCCGAACGTTAAACGGTGACTCCTTGTCCAGAATA

Full Affymetrix probeset data:

Annotations for 1637871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720