Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637872_at:

>probe:Drosophila_2:1637872_at:429:77; Interrogation_Position=1043; Antisense; AGGAGTGCTCCAAGCGACTGCAGTT
>probe:Drosophila_2:1637872_at:548:497; Interrogation_Position=1085; Antisense; GTCTTGAGATGTTTGTGTCGCGCGA
>probe:Drosophila_2:1637872_at:207:479; Interrogation_Position=1118; Antisense; GTTTGCCCACGGTGAACACGATTAA
>probe:Drosophila_2:1637872_at:568:625; Interrogation_Position=1145; Antisense; TGCCCTTCGGCGTCGACTGGAAAAA
>probe:Drosophila_2:1637872_at:184:171; Interrogation_Position=1167; Antisense; AAAGGTGGCCGAGTACGCCATGCGC
>probe:Drosophila_2:1637872_at:39:97; Interrogation_Position=1205; Antisense; AGATTAGCGGTGGTCTGGGTCCCAC
>probe:Drosophila_2:1637872_at:701:109; Interrogation_Position=1235; Antisense; AGCACGTCTTCCGTATCGGTTTAAT
>probe:Drosophila_2:1637872_at:711:175; Interrogation_Position=1266; Antisense; AAACGCTACCGTGGAGCGCGTGGAC
>probe:Drosophila_2:1637872_at:659:585; Interrogation_Position=1286; Antisense; TGGACATGGTGCTCAGCATCCTGAA
>probe:Drosophila_2:1637872_at:213:237; Interrogation_Position=1359; Antisense; AATCTAACAAATCGTTGCCCTGCTC
>probe:Drosophila_2:1637872_at:560:321; Interrogation_Position=1375; Antisense; GCCCTGCTCCTATCACTAGTTATAA
>probe:Drosophila_2:1637872_at:278:19; Interrogation_Position=826; Antisense; ATTTCGTTCAGCAAGCGTGCTTTGA
>probe:Drosophila_2:1637872_at:250:479; Interrogation_Position=883; Antisense; GTTTACTACTTCGATATCCTGCTGA
>probe:Drosophila_2:1637872_at:467:141; Interrogation_Position=977; Antisense; ACGGATTGCGTGAGGCACTGGCCCA

Paste this into a BLAST search page for me
AGGAGTGCTCCAAGCGACTGCAGTTGTCTTGAGATGTTTGTGTCGCGCGAGTTTGCCCACGGTGAACACGATTAATGCCCTTCGGCGTCGACTGGAAAAAAAAGGTGGCCGAGTACGCCATGCGCAGATTAGCGGTGGTCTGGGTCCCACAGCACGTCTTCCGTATCGGTTTAATAAACGCTACCGTGGAGCGCGTGGACTGGACATGGTGCTCAGCATCCTGAAAATCTAACAAATCGTTGCCCTGCTCGCCCTGCTCCTATCACTAGTTATAAATTTCGTTCAGCAAGCGTGCTTTGAGTTTACTACTTCGATATCCTGCTGAACGGATTGCGTGAGGCACTGGCCCA

Full Affymetrix probeset data:

Annotations for 1637872_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime