Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637873_at:

>probe:Drosophila_2:1637873_at:379:453; Interrogation_Position=1000; Antisense; GATAAAGTATTCCAATTTATTGGTG
>probe:Drosophila_2:1637873_at:631:257; Interrogation_Position=804; Antisense; CACAGACGATGTAGGCATGGAATGG
>probe:Drosophila_2:1637873_at:208:601; Interrogation_Position=813; Antisense; TGTAGGCATGGAATGGACTTCGATT
>probe:Drosophila_2:1637873_at:94:371; Interrogation_Position=823; Antisense; GAATGGACTTCGATTGATGGGACAA
>probe:Drosophila_2:1637873_at:221:401; Interrogation_Position=828; Antisense; GACTTCGATTGATGGGACAATGGAA
>probe:Drosophila_2:1637873_at:658:491; Interrogation_Position=865; Antisense; GTAACATTTTAGTTTAAGAGTGCTA
>probe:Drosophila_2:1637873_at:615:703; Interrogation_Position=910; Antisense; TTATGTTTGCTGTAAGTAACGGATT
>probe:Drosophila_2:1637873_at:408:1; Interrogation_Position=925; Antisense; GTAACGGATTTGTGCTATCCAAACA
>probe:Drosophila_2:1637873_at:567:459; Interrogation_Position=931; Antisense; GATTTGTGCTATCCAAACAGCTGTT
>probe:Drosophila_2:1637873_at:60:181; Interrogation_Position=945; Antisense; AAACAGCTGTTTGCCCAGCAAGTGG
>probe:Drosophila_2:1637873_at:46:603; Interrogation_Position=952; Antisense; TGTTTGCCCAGCAAGTGGGCAGCCC
>probe:Drosophila_2:1637873_at:312:51; Interrogation_Position=961; Antisense; AGCAAGTGGGCAGCCCCCTTTATAC
>probe:Drosophila_2:1637873_at:542:305; Interrogation_Position=977; Antisense; CCTTTATACACCCTGTAACTGTGGA
>probe:Drosophila_2:1637873_at:283:29; Interrogation_Position=982; Antisense; ATACACCCTGTAACTGTGGATAAAG

Paste this into a BLAST search page for me
GATAAAGTATTCCAATTTATTGGTGCACAGACGATGTAGGCATGGAATGGTGTAGGCATGGAATGGACTTCGATTGAATGGACTTCGATTGATGGGACAAGACTTCGATTGATGGGACAATGGAAGTAACATTTTAGTTTAAGAGTGCTATTATGTTTGCTGTAAGTAACGGATTGTAACGGATTTGTGCTATCCAAACAGATTTGTGCTATCCAAACAGCTGTTAAACAGCTGTTTGCCCAGCAAGTGGTGTTTGCCCAGCAAGTGGGCAGCCCAGCAAGTGGGCAGCCCCCTTTATACCCTTTATACACCCTGTAACTGTGGAATACACCCTGTAACTGTGGATAAAG

Full Affymetrix probeset data:

Annotations for 1637873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime