Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637874_at:

>probe:Drosophila_2:1637874_at:292:311; Interrogation_Position=2139; Antisense; GCCAACTACGTGGAGCAGGCGGTTA
>probe:Drosophila_2:1637874_at:597:81; Interrogation_Position=2170; Antisense; AGGGAATGTTCTACTACTGCTGCTG
>probe:Drosophila_2:1637874_at:589:263; Interrogation_Position=2199; Antisense; CAGCAGTTTGTGGTGATCCTCGTCT
>probe:Drosophila_2:1637874_at:306:635; Interrogation_Position=2248; Antisense; TCGCCTTCTTCGTCAACGTTTTTAT
>probe:Drosophila_2:1637874_at:122:255; Interrogation_Position=2261; Antisense; CAACGTTTTTATCGCGGATCGCAAC
>probe:Drosophila_2:1637874_at:38:547; Interrogation_Position=2276; Antisense; GGATCGCAACATGCACGCGAATCTA
>probe:Drosophila_2:1637874_at:714:643; Interrogation_Position=2297; Antisense; TCTAATGATGAGGAACGGTCGGCAC
>probe:Drosophila_2:1637874_at:714:161; Interrogation_Position=2371; Antisense; ACAATCCGTACGACATGCATGGCTA
>probe:Drosophila_2:1637874_at:395:617; Interrogation_Position=2386; Antisense; TGCATGGCTACAACCACTACAGCAA
>probe:Drosophila_2:1637874_at:414:665; Interrogation_Position=2403; Antisense; TACAGCAACTACCATCCGCAAGTGG
>probe:Drosophila_2:1637874_at:516:361; Interrogation_Position=2420; Antisense; GCAAGTGGATTCCAAGCAGCAGCAG
>probe:Drosophila_2:1637874_at:209:205; Interrogation_Position=2473; Antisense; AAGCCGAGCAGGACATTTACTACTA
>probe:Drosophila_2:1637874_at:451:239; Interrogation_Position=2502; Antisense; AATCATGTATTCAGGCGGCGACGGC
>probe:Drosophila_2:1637874_at:470:191; Interrogation_Position=2588; Antisense; AACTTATACTGCATCCACTACATAC

Paste this into a BLAST search page for me
GCCAACTACGTGGAGCAGGCGGTTAAGGGAATGTTCTACTACTGCTGCTGCAGCAGTTTGTGGTGATCCTCGTCTTCGCCTTCTTCGTCAACGTTTTTATCAACGTTTTTATCGCGGATCGCAACGGATCGCAACATGCACGCGAATCTATCTAATGATGAGGAACGGTCGGCACACAATCCGTACGACATGCATGGCTATGCATGGCTACAACCACTACAGCAATACAGCAACTACCATCCGCAAGTGGGCAAGTGGATTCCAAGCAGCAGCAGAAGCCGAGCAGGACATTTACTACTAAATCATGTATTCAGGCGGCGACGGCAACTTATACTGCATCCACTACATAC

Full Affymetrix probeset data:

Annotations for 1637874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime