Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637876_a_at:

>probe:Drosophila_2:1637876_a_at:54:85; Interrogation_Position=1016; Antisense; AGTGTATGGCATACGCCCGACGATA
>probe:Drosophila_2:1637876_a_at:43:31; Interrogation_Position=1038; Antisense; ATAACGCCAGCGTGATCGATTATGC
>probe:Drosophila_2:1637876_a_at:598:405; Interrogation_Position=1066; Antisense; GACGGACAACCTGGCACTGATTATA
>probe:Drosophila_2:1637876_a_at:304:603; Interrogation_Position=1083; Antisense; TGATTATACGGCTCTTCGCTTTGGA
>probe:Drosophila_2:1637876_a_at:284:691; Interrogation_Position=1102; Antisense; TTTGGAGTATCTGCTGGCCGGAACC
>probe:Drosophila_2:1637876_a_at:222:607; Interrogation_Position=618; Antisense; TGATGCTCTTGTTCTTCGATGGCGA
>probe:Drosophila_2:1637876_a_at:666:527; Interrogation_Position=661; Antisense; GGGACCCAAGGACTCCATCTATGGA
>probe:Drosophila_2:1637876_a_at:117:553; Interrogation_Position=683; Antisense; GGAGCACGACACCTGGCCAAAAAGT
>probe:Drosophila_2:1637876_a_at:65:287; Interrogation_Position=777; Antisense; CGGCATTCTACAGCTTCTTCGAAAA
>probe:Drosophila_2:1637876_a_at:137:181; Interrogation_Position=799; Antisense; AAACACCGAGTCCTGGTACATGCGT
>probe:Drosophila_2:1637876_a_at:575:489; Interrogation_Position=814; Antisense; GTACATGCGTATCCAGTCCGTGGAG
>probe:Drosophila_2:1637876_a_at:662:423; Interrogation_Position=836; Antisense; GAGACACGTCTTGCCAAGTTGCAGC
>probe:Drosophila_2:1637876_a_at:461:49; Interrogation_Position=873; Antisense; ATGCCAGCAGTGGAGTTGCCCAGCG
>probe:Drosophila_2:1637876_a_at:480:167; Interrogation_Position=976; Antisense; AAATGTGCCGATCTTGCACCTCATT

Paste this into a BLAST search page for me
AGTGTATGGCATACGCCCGACGATAATAACGCCAGCGTGATCGATTATGCGACGGACAACCTGGCACTGATTATATGATTATACGGCTCTTCGCTTTGGATTTGGAGTATCTGCTGGCCGGAACCTGATGCTCTTGTTCTTCGATGGCGAGGGACCCAAGGACTCCATCTATGGAGGAGCACGACACCTGGCCAAAAAGTCGGCATTCTACAGCTTCTTCGAAAAAAACACCGAGTCCTGGTACATGCGTGTACATGCGTATCCAGTCCGTGGAGGAGACACGTCTTGCCAAGTTGCAGCATGCCAGCAGTGGAGTTGCCCAGCGAAATGTGCCGATCTTGCACCTCATT

Full Affymetrix probeset data:

Annotations for 1637876_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime