FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637880_at:

>probe:Drosophila_2:1637880_at:371:703; Interrogation_Position=1024; Antisense; TTATTATGATTTTCGCTTCTTCTTC
>probe:Drosophila_2:1637880_at:574:247; Interrogation_Position=609; Antisense; AATTGCCCAGTAATTTGCAACCCAA
>probe:Drosophila_2:1637880_at:141:247; Interrogation_Position=645; Antisense; AATTCGCAGGAAAACTCTCTGGTTA
>probe:Drosophila_2:1637880_at:240:165; Interrogation_Position=700; Antisense; AAATCTTCCCCACACAACTATACAA
>probe:Drosophila_2:1637880_at:322:685; Interrogation_Position=718; Antisense; TATACAACACAACACTACACACCGA
>probe:Drosophila_2:1637880_at:702:453; Interrogation_Position=741; Antisense; GATTACCAGTAATTAACCCAAAGCA
>probe:Drosophila_2:1637880_at:595:171; Interrogation_Position=760; Antisense; AAAGCACTCGAAAGCACCACAATCA
>probe:Drosophila_2:1637880_at:542:671; Interrogation_Position=791; Antisense; TTGCGCACCAGCACCGGAAACGGAA
>probe:Drosophila_2:1637880_at:179:559; Interrogation_Position=806; Antisense; GGAAACGGAAATGCGTCCCTCTTAG
>probe:Drosophila_2:1637880_at:485:233; Interrogation_Position=815; Antisense; AATGCGTCCCTCTTAGCTAATTGCA
>probe:Drosophila_2:1637880_at:257:707; Interrogation_Position=827; Antisense; TTAGCTAATTGCAGACACCCACAAG
>probe:Drosophila_2:1637880_at:257:255; Interrogation_Position=852; Antisense; CAAAAATACACACTAACGCGGCACC
>probe:Drosophila_2:1637880_at:296:133; Interrogation_Position=973; Antisense; ACGCTATTGAGTTATTTTCCACCTT
>probe:Drosophila_2:1637880_at:557:627; Interrogation_Position=990; Antisense; TCCACCTTATTGTTTCGTTTTGTAT

Paste this into a BLAST search page for me
TTATTATGATTTTCGCTTCTTCTTCAATTGCCCAGTAATTTGCAACCCAAAATTCGCAGGAAAACTCTCTGGTTAAAATCTTCCCCACACAACTATACAATATACAACACAACACTACACACCGAGATTACCAGTAATTAACCCAAAGCAAAAGCACTCGAAAGCACCACAATCATTGCGCACCAGCACCGGAAACGGAAGGAAACGGAAATGCGTCCCTCTTAGAATGCGTCCCTCTTAGCTAATTGCATTAGCTAATTGCAGACACCCACAAGCAAAAATACACACTAACGCGGCACCACGCTATTGAGTTATTTTCCACCTTTCCACCTTATTGTTTCGTTTTGTAT

Full Affymetrix probeset data:

Annotations for 1637880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720