FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637881_at:

>probe:Drosophila_2:1637881_at:20:495; Interrogation_Position=1011; Antisense; GTCAATGTTGATCCTTGCAAAGCAA
>probe:Drosophila_2:1637881_at:430:13; Interrogation_Position=581; Antisense; ATTACTGGTCTGCTGGTGCAGGCTT
>probe:Drosophila_2:1637881_at:528:507; Interrogation_Position=596; Antisense; GTGCAGGCTTTGATCATAGGCGTTA
>probe:Drosophila_2:1637881_at:723:703; Interrogation_Position=618; Antisense; TTATCTGGCAGTTCTTCAGCGGAAA
>probe:Drosophila_2:1637881_at:367:183; Interrogation_Position=647; Antisense; AAGAAGAACTTCATCGCCAGTCGTC
>probe:Drosophila_2:1637881_at:400:501; Interrogation_Position=666; Antisense; GTCGTCTGACTGGTGGAAATGCCAA
>probe:Drosophila_2:1637881_at:257:229; Interrogation_Position=717; Antisense; AATGGTACATACTGGCTGGAGCTCT
>probe:Drosophila_2:1637881_at:464:549; Interrogation_Position=746; Antisense; GGAGGTTATCTTCTTCTGCATCTGC
>probe:Drosophila_2:1637881_at:507:349; Interrogation_Position=776; Antisense; GCAGTGCTTTTGACGATTTTCACCG
>probe:Drosophila_2:1637881_at:462:15; Interrogation_Position=791; Antisense; ATTTTCACCGTGTTGCTACCTATTT
>probe:Drosophila_2:1637881_at:47:335; Interrogation_Position=865; Antisense; GCTGACCAACAGCATCGAGAGCTTT
>probe:Drosophila_2:1637881_at:704:63; Interrogation_Position=905; Antisense; ATGGGCTCCTTGCTGGATGCCTTAA
>probe:Drosophila_2:1637881_at:629:429; Interrogation_Position=920; Antisense; GATGCCTTAAATGTCCGGGCCGAAG
>probe:Drosophila_2:1637881_at:425:635; Interrogation_Position=996; Antisense; TCGCTAGTTATCCTTGTCAATGTTG

Paste this into a BLAST search page for me
GTCAATGTTGATCCTTGCAAAGCAAATTACTGGTCTGCTGGTGCAGGCTTGTGCAGGCTTTGATCATAGGCGTTATTATCTGGCAGTTCTTCAGCGGAAAAAGAAGAACTTCATCGCCAGTCGTCGTCGTCTGACTGGTGGAAATGCCAAAATGGTACATACTGGCTGGAGCTCTGGAGGTTATCTTCTTCTGCATCTGCGCAGTGCTTTTGACGATTTTCACCGATTTTCACCGTGTTGCTACCTATTTGCTGACCAACAGCATCGAGAGCTTTATGGGCTCCTTGCTGGATGCCTTAAGATGCCTTAAATGTCCGGGCCGAAGTCGCTAGTTATCCTTGTCAATGTTG

Full Affymetrix probeset data:

Annotations for 1637881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720