FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637884_at:

>probe:Drosophila_2:1637884_at:210:561; Interrogation_Position=116; Antisense; GGAAACTCCATATATCTCGTGTACA
>probe:Drosophila_2:1637884_at:135:137; Interrogation_Position=146; Antisense; ACGACTCCGGAAGTTATATGTGCCA
>probe:Drosophila_2:1637884_at:107:665; Interrogation_Position=177; Antisense; TACAGATCCGATGAAGAGCCTTTCC
>probe:Drosophila_2:1637884_at:111:415; Interrogation_Position=192; Antisense; GAGCCTTTCCGGATATTTAGATGTT
>probe:Drosophila_2:1637884_at:602:467; Interrogation_Position=214; Antisense; GTTGTTGTACCTCCAGATATTTTAA
>probe:Drosophila_2:1637884_at:719:653; Interrogation_Position=252; Antisense; TAATCCAGAGGACGGCGTCTGTCAA
>probe:Drosophila_2:1637884_at:8:375; Interrogation_Position=284; Antisense; GAAGTATTTCACTTATGTGCAGCGT
>probe:Drosophila_2:1637884_at:621:61; Interrogation_Position=298; Antisense; ATGTGCAGCGTGACAGGCGTTCCAA
>probe:Drosophila_2:1637884_at:280:573; Interrogation_Position=313; Antisense; GGCGTTCCAAGACCAAAAGTACTGT
>probe:Drosophila_2:1637884_at:447:31; Interrogation_Position=361; Antisense; ATAATACTTCGCACGGATGGTAGAG
>probe:Drosophila_2:1637884_at:227:67; Interrogation_Position=38; Antisense; AGGCCATACTTGGTATACACACCCA
>probe:Drosophila_2:1637884_at:553:151; Interrogation_Position=391; Antisense; ACAGGTTATTATGCTACGTTCCACA
>probe:Drosophila_2:1637884_at:511:133; Interrogation_Position=58; Antisense; ACCCACATGGTCTCACTAAATCCAA
>probe:Drosophila_2:1637884_at:458:703; Interrogation_Position=85; Antisense; TTATCTGTAACACATAACGGCCACA

Paste this into a BLAST search page for me
GGAAACTCCATATATCTCGTGTACAACGACTCCGGAAGTTATATGTGCCATACAGATCCGATGAAGAGCCTTTCCGAGCCTTTCCGGATATTTAGATGTTGTTGTTGTACCTCCAGATATTTTAATAATCCAGAGGACGGCGTCTGTCAAGAAGTATTTCACTTATGTGCAGCGTATGTGCAGCGTGACAGGCGTTCCAAGGCGTTCCAAGACCAAAAGTACTGTATAATACTTCGCACGGATGGTAGAGAGGCCATACTTGGTATACACACCCAACAGGTTATTATGCTACGTTCCACAACCCACATGGTCTCACTAAATCCAATTATCTGTAACACATAACGGCCACA

Full Affymetrix probeset data:

Annotations for 1637884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720