FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637886_at:

>probe:Drosophila_2:1637886_at:94:547; Interrogation_Position=1227; Antisense; GGATGCCATCAACTTTATGTACGCA
>probe:Drosophila_2:1637886_at:89:167; Interrogation_Position=1251; Antisense; AAATGACTCGGATACGGACGCCAAG
>probe:Drosophila_2:1637886_at:573:1; Interrogation_Position=1294; Antisense; ATTAGTGCCCACACCGAAAAGTTCT
>probe:Drosophila_2:1637886_at:175:389; Interrogation_Position=1309; Antisense; GAAAAGTTCTACATCACACCCATGC
>probe:Drosophila_2:1637886_at:112:103; Interrogation_Position=1334; Antisense; AGACGTTCGCCGATCTGATCAGTAA
>probe:Drosophila_2:1637886_at:400:117; Interrogation_Position=1375; Antisense; AGCTACCTGTTTAGGATGCGGCCGA
>probe:Drosophila_2:1637886_at:555:39; Interrogation_Position=1415; Antisense; ATCTGCCCAGCTGGATAAGTGTGCC
>probe:Drosophila_2:1637886_at:506:655; Interrogation_Position=1430; Antisense; TAAGTGTGCCCAAGTACTTCGACCA
>probe:Drosophila_2:1637886_at:257:667; Interrogation_Position=1444; Antisense; TACTTCGACCAGATCTTCGTGTGGG
>probe:Drosophila_2:1637886_at:698:151; Interrogation_Position=1478; Antisense; ACATGACCAACTCCGTTGACTGGAA
>probe:Drosophila_2:1637886_at:662:401; Interrogation_Position=1525; Antisense; GACATCATCATGACCCTGTGGGCGA
>probe:Drosophila_2:1637886_at:512:507; Interrogation_Position=1627; Antisense; GTGCTTCTGATCGACGAGAGCTTCA
>probe:Drosophila_2:1637886_at:603:33; Interrogation_Position=1681; Antisense; ATCAACTTCTGGAGATCGCTGTACC
>probe:Drosophila_2:1637886_at:175:717; Interrogation_Position=1781; Antisense; TTCCCATACTATGTACCCTTAGCAT

Paste this into a BLAST search page for me
GGATGCCATCAACTTTATGTACGCAAAATGACTCGGATACGGACGCCAAGATTAGTGCCCACACCGAAAAGTTCTGAAAAGTTCTACATCACACCCATGCAGACGTTCGCCGATCTGATCAGTAAAGCTACCTGTTTAGGATGCGGCCGAATCTGCCCAGCTGGATAAGTGTGCCTAAGTGTGCCCAAGTACTTCGACCATACTTCGACCAGATCTTCGTGTGGGACATGACCAACTCCGTTGACTGGAAGACATCATCATGACCCTGTGGGCGAGTGCTTCTGATCGACGAGAGCTTCAATCAACTTCTGGAGATCGCTGTACCTTCCCATACTATGTACCCTTAGCAT

Full Affymetrix probeset data:

Annotations for 1637886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720