FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637887_at:

>probe:Drosophila_2:1637887_at:719:99; Interrogation_Position=2373; Antisense; AGAGTACCTGCAGCGTCTGTTCAAT
>probe:Drosophila_2:1637887_at:132:729; Interrogation_Position=2435; Antisense; TTGGTTTGGTCAGTCATGCACACAC
>probe:Drosophila_2:1637887_at:567:609; Interrogation_Position=2511; Antisense; TGAGCTATGCTTGAGTGCGCCGGAT
>probe:Drosophila_2:1637887_at:289:323; Interrogation_Position=2527; Antisense; GCGCCGGATGTACTAATTCTCGATG
>probe:Drosophila_2:1637887_at:317:637; Interrogation_Position=2573; Antisense; TCGAGAGTATCGACGCCTTGGCGGA
>probe:Drosophila_2:1637887_at:410:137; Interrogation_Position=2639; Antisense; ACGACGAGCGTTTGATCCGTGAAAC
>probe:Drosophila_2:1637887_at:347:611; Interrogation_Position=2658; Antisense; TGAAACAGGTTGCACTCTCTACGTA
>probe:Drosophila_2:1637887_at:221:169; Interrogation_Position=2733; Antisense; AAAGGAGGTTCTCGATTCGCTCGGC
>probe:Drosophila_2:1637887_at:429:719; Interrogation_Position=2748; Antisense; TTCGCTCGGCGAGGTGGTCAACAAT
>probe:Drosophila_2:1637887_at:666:183; Interrogation_Position=2767; Antisense; AACAATCCTAGCGTGGTGGCCAATG
>probe:Drosophila_2:1637887_at:526:579; Interrogation_Position=2784; Antisense; GGCCAATGCGGCTGTGCTGCAATAA
>probe:Drosophila_2:1637887_at:22:31; Interrogation_Position=2805; Antisense; ATAACCCTCAAGTTGCATACGGACT
>probe:Drosophila_2:1637887_at:146:55; Interrogation_Position=2838; Antisense; ATGCAACTGGTCATCACTCGTCAGC
>probe:Drosophila_2:1637887_at:37:573; Interrogation_Position=2864; Antisense; GGCTCGCCCTATGTTAATTGTTCAA

Paste this into a BLAST search page for me
AGAGTACCTGCAGCGTCTGTTCAATTTGGTTTGGTCAGTCATGCACACACTGAGCTATGCTTGAGTGCGCCGGATGCGCCGGATGTACTAATTCTCGATGTCGAGAGTATCGACGCCTTGGCGGAACGACGAGCGTTTGATCCGTGAAACTGAAACAGGTTGCACTCTCTACGTAAAAGGAGGTTCTCGATTCGCTCGGCTTCGCTCGGCGAGGTGGTCAACAATAACAATCCTAGCGTGGTGGCCAATGGGCCAATGCGGCTGTGCTGCAATAAATAACCCTCAAGTTGCATACGGACTATGCAACTGGTCATCACTCGTCAGCGGCTCGCCCTATGTTAATTGTTCAA

Full Affymetrix probeset data:

Annotations for 1637887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720