FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637888_at:

>probe:Drosophila_2:1637888_at:140:421; Interrogation_Position=1998; Antisense; GAGCACAACCAGCTCCTTGTACGGA
>probe:Drosophila_2:1637888_at:463:397; Interrogation_Position=2035; Antisense; GACAAGCTGTATCTGAGGGCCGCAT
>probe:Drosophila_2:1637888_at:173:81; Interrogation_Position=2111; Antisense; AGGTGACTGCATCTGGTTCAGCTTC
>probe:Drosophila_2:1637888_at:267:213; Interrogation_Position=2140; Antisense; AAGAGCGGCGCTTCTCAGGATGAGT
>probe:Drosophila_2:1637888_at:237:445; Interrogation_Position=2158; Antisense; GATGAGTATGTGACCCTGCAGCCAA
>probe:Drosophila_2:1637888_at:21:21; Interrogation_Position=2216; Antisense; ATTTGCACCAGTCACAGCCAGCGGC
>probe:Drosophila_2:1637888_at:197:81; Interrogation_Position=2393; Antisense; AGGTGGGCCAGCGACAAACTCTAGT
>probe:Drosophila_2:1637888_at:689:191; Interrogation_Position=2409; Antisense; AACTCTAGTCGCCATCAACACGGAC
>probe:Drosophila_2:1637888_at:302:35; Interrogation_Position=2437; Antisense; ATCACGGAGAGCATCGCGGTGCACA
>probe:Drosophila_2:1637888_at:621:95; Interrogation_Position=2468; Antisense; AGATTGTCACGCTGTGCGAGTGCCG
>probe:Drosophila_2:1637888_at:481:325; Interrogation_Position=2483; Antisense; GCGAGTGCCGCGAGTCCAAGGATCA
>probe:Drosophila_2:1637888_at:519:223; Interrogation_Position=2500; Antisense; AAGGATCAGCGCCAGTGGTTCTACG
>probe:Drosophila_2:1637888_at:7:81; Interrogation_Position=2533; Antisense; AGGGACGGACGCGAAGGCTTCATTC
>probe:Drosophila_2:1637888_at:565:79; Interrogation_Position=2564; Antisense; AGGTGGCCGGCCATGGCTACCTGTA

Paste this into a BLAST search page for me
GAGCACAACCAGCTCCTTGTACGGAGACAAGCTGTATCTGAGGGCCGCATAGGTGACTGCATCTGGTTCAGCTTCAAGAGCGGCGCTTCTCAGGATGAGTGATGAGTATGTGACCCTGCAGCCAAATTTGCACCAGTCACAGCCAGCGGCAGGTGGGCCAGCGACAAACTCTAGTAACTCTAGTCGCCATCAACACGGACATCACGGAGAGCATCGCGGTGCACAAGATTGTCACGCTGTGCGAGTGCCGGCGAGTGCCGCGAGTCCAAGGATCAAAGGATCAGCGCCAGTGGTTCTACGAGGGACGGACGCGAAGGCTTCATTCAGGTGGCCGGCCATGGCTACCTGTA

Full Affymetrix probeset data:

Annotations for 1637888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720