Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637889_at:

>probe:Drosophila_2:1637889_at:70:217; Interrogation_Position=1008; Antisense; AAGTATTTCGACGTTGTCACGCAAA
>probe:Drosophila_2:1637889_at:342:181; Interrogation_Position=1030; Antisense; AAAACTGCAGCTCAACTCACTTAGT
>probe:Drosophila_2:1637889_at:473:675; Interrogation_Position=1051; Antisense; TAGTTTACGGAGCTTGTTCCTCTTA
>probe:Drosophila_2:1637889_at:27:469; Interrogation_Position=1066; Antisense; GTTCCTCTTAACTGCTAGGCATTTG
>probe:Drosophila_2:1637889_at:332:681; Interrogation_Position=1081; Antisense; TAGGCATTTGCCAGCTGTTCGTAAA
>probe:Drosophila_2:1637889_at:10:407; Interrogation_Position=619; Antisense; GACTGTATTACAACGTGGCCACCGG
>probe:Drosophila_2:1637889_at:110:477; Interrogation_Position=666; Antisense; GTTATCTGCGAGAACCATCCGTTGC
>probe:Drosophila_2:1637889_at:421:287; Interrogation_Position=717; Antisense; CTGGCGGTGCGCAACAAATTCGTTT
>probe:Drosophila_2:1637889_at:351:681; Interrogation_Position=746; Antisense; TATGGCCACATGTCGCGGATATTAC
>probe:Drosophila_2:1637889_at:71:543; Interrogation_Position=762; Antisense; GGATATTACTACTGCCGCGATTTGG
>probe:Drosophila_2:1637889_at:212:293; Interrogation_Position=806; Antisense; CGATCCCATATACCAGCAGTGTGAC
>probe:Drosophila_2:1637889_at:374:187; Interrogation_Position=834; Antisense; AACAACTTCTTCAACCAGGAGCGAC
>probe:Drosophila_2:1637889_at:349:619; Interrogation_Position=864; Antisense; TGCATGCCGCGCGAGAGCCAGAAAT
>probe:Drosophila_2:1637889_at:157:441; Interrogation_Position=942; Antisense; GATGGATGCCACCACTACATCGAAT

Paste this into a BLAST search page for me
AAGTATTTCGACGTTGTCACGCAAAAAAACTGCAGCTCAACTCACTTAGTTAGTTTACGGAGCTTGTTCCTCTTAGTTCCTCTTAACTGCTAGGCATTTGTAGGCATTTGCCAGCTGTTCGTAAAGACTGTATTACAACGTGGCCACCGGGTTATCTGCGAGAACCATCCGTTGCCTGGCGGTGCGCAACAAATTCGTTTTATGGCCACATGTCGCGGATATTACGGATATTACTACTGCCGCGATTTGGCGATCCCATATACCAGCAGTGTGACAACAACTTCTTCAACCAGGAGCGACTGCATGCCGCGCGAGAGCCAGAAATGATGGATGCCACCACTACATCGAAT

Full Affymetrix probeset data:

Annotations for 1637889_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime