Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637892_at:

>probe:Drosophila_2:1637892_at:620:719; Interrogation_Position=1488; Antisense; TTCCTACCCGGATGCATATTCAAAT
>probe:Drosophila_2:1637892_at:521:11; Interrogation_Position=1505; Antisense; ATTCAAATTTGGACCTCACCACGGC
>probe:Drosophila_2:1637892_at:504:607; Interrogation_Position=1535; Antisense; TGATGGGCACTGCATTCAGTCCAAC
>probe:Drosophila_2:1637892_at:439:189; Interrogation_Position=1576; Antisense; AACATGGGCTACATTCGCAGCTGGA
>probe:Drosophila_2:1637892_at:252:277; Interrogation_Position=1609; Antisense; CTTAACTTCACCCTTATGGTCACAT
>probe:Drosophila_2:1637892_at:356:141; Interrogation_Position=1660; Antisense; ACGGCGACCATATTCTCCATAAGAA
>probe:Drosophila_2:1637892_at:210:257; Interrogation_Position=1693; Antisense; CACAATCTTTATCTGGAGGCCTGCA
>probe:Drosophila_2:1637892_at:358:407; Interrogation_Position=1720; Antisense; GACGGACTGCGTTTGTATTTGGAGC
>probe:Drosophila_2:1637892_at:590:345; Interrogation_Position=1800; Antisense; GCATCAAGTGGCCATCAGCATACAG
>probe:Drosophila_2:1637892_at:98:461; Interrogation_Position=1842; Antisense; GATTTACGTCGATTGCGCGTGGACA
>probe:Drosophila_2:1637892_at:440:255; Interrogation_Position=1865; Antisense; CAAACAGTTTCGTTGTCTCCAAGCG
>probe:Drosophila_2:1637892_at:653:249; Interrogation_Position=1884; Antisense; CAAGCGACTTTTTACGTTGCCCGTG
>probe:Drosophila_2:1637892_at:615:41; Interrogation_Position=1924; Antisense; ATCGGACGCGGCTTCAATGGTGAAC
>probe:Drosophila_2:1637892_at:614:323; Interrogation_Position=2028; Antisense; GCGCTATATCATCGACACATTCATC

Paste this into a BLAST search page for me
TTCCTACCCGGATGCATATTCAAATATTCAAATTTGGACCTCACCACGGCTGATGGGCACTGCATTCAGTCCAACAACATGGGCTACATTCGCAGCTGGACTTAACTTCACCCTTATGGTCACATACGGCGACCATATTCTCCATAAGAACACAATCTTTATCTGGAGGCCTGCAGACGGACTGCGTTTGTATTTGGAGCGCATCAAGTGGCCATCAGCATACAGGATTTACGTCGATTGCGCGTGGACACAAACAGTTTCGTTGTCTCCAAGCGCAAGCGACTTTTTACGTTGCCCGTGATCGGACGCGGCTTCAATGGTGAACGCGCTATATCATCGACACATTCATC

Full Affymetrix probeset data:

Annotations for 1637892_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime