FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637893_at:

>probe:Drosophila_2:1637893_at:677:325; Interrogation_Position=234; Antisense; GCGACTGCATTACGCCGCAGGAATA
>probe:Drosophila_2:1637893_at:186:287; Interrogation_Position=281; Antisense; CTGGTGCAGTACAAGGTGGCCTTTA
>probe:Drosophila_2:1637893_at:693:111; Interrogation_Position=306; Antisense; AGCAGGTGCAGTGCGACGAATTCCC
>probe:Drosophila_2:1637893_at:371:357; Interrogation_Position=323; Antisense; GAATTCCCCTCGGTGGAGACGTTCG
>probe:Drosophila_2:1637893_at:393:211; Interrogation_Position=350; Antisense; AAGAAATTCCGGCTGGACTGCCCTG
>probe:Drosophila_2:1637893_at:516:657; Interrogation_Position=424; Antisense; TAAGGGCAACACCTCCAAATGCATC
>probe:Drosophila_2:1637893_at:658:97; Interrogation_Position=453; Antisense; AGATCGTGTCGCTGTTCATCACAAT
>probe:Drosophila_2:1637893_at:435:67; Interrogation_Position=479; Antisense; ATGGACAAGCTACGCCTGCAGATCA
>probe:Drosophila_2:1637893_at:601:211; Interrogation_Position=534; Antisense; AAGACCTGGCTGACAACATGAATCG
>probe:Drosophila_2:1637893_at:189:425; Interrogation_Position=626; Antisense; GAGATGCAGGCCTCCGACGAGTTGA
>probe:Drosophila_2:1637893_at:46:573; Interrogation_Position=691; Antisense; GGCGTACGCGGACTTCAACAAGCTG
>probe:Drosophila_2:1637893_at:351:127; Interrogation_Position=722; Antisense; AGCCAGTAGCTATCAGTTTCTCATT
>probe:Drosophila_2:1637893_at:196:479; Interrogation_Position=737; Antisense; GTTTCTCATTGTTTACGTGTATCCC
>probe:Drosophila_2:1637893_at:81:23; Interrogation_Position=802; Antisense; ATATCACCTTACTTTTAGCGCAGAC

Paste this into a BLAST search page for me
GCGACTGCATTACGCCGCAGGAATACTGGTGCAGTACAAGGTGGCCTTTAAGCAGGTGCAGTGCGACGAATTCCCGAATTCCCCTCGGTGGAGACGTTCGAAGAAATTCCGGCTGGACTGCCCTGTAAGGGCAACACCTCCAAATGCATCAGATCGTGTCGCTGTTCATCACAATATGGACAAGCTACGCCTGCAGATCAAAGACCTGGCTGACAACATGAATCGGAGATGCAGGCCTCCGACGAGTTGAGGCGTACGCGGACTTCAACAAGCTGAGCCAGTAGCTATCAGTTTCTCATTGTTTCTCATTGTTTACGTGTATCCCATATCACCTTACTTTTAGCGCAGAC

Full Affymetrix probeset data:

Annotations for 1637893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720