Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637894_at:

>probe:Drosophila_2:1637894_at:563:87; Interrogation_Position=1555; Antisense; AGTCGCAGGACCAGTCGCTGATCAC
>probe:Drosophila_2:1637894_at:275:333; Interrogation_Position=1571; Antisense; GCTGATCACCAACATCACCACGAAT
>probe:Drosophila_2:1637894_at:195:425; Interrogation_Position=1605; Antisense; GAGAGCGTTACCGTCGAGATCATCG
>probe:Drosophila_2:1637894_at:310:641; Interrogation_Position=1624; Antisense; TCATCGAGCCGGGTCAGAAGTAAGG
>probe:Drosophila_2:1637894_at:243:439; Interrogation_Position=1655; Antisense; GATGGCTACTTCGAGCACAAAGCTT
>probe:Drosophila_2:1637894_at:306:357; Interrogation_Position=1669; Antisense; GCACAAAGCTTGATTTTGCATTGGA
>probe:Drosophila_2:1637894_at:616:461; Interrogation_Position=1696; Antisense; GATTAACTGGCTAACTCTCTGACAC
>probe:Drosophila_2:1637894_at:398:193; Interrogation_Position=1708; Antisense; AACTCTCTGACACACGACAACAGGA
>probe:Drosophila_2:1637894_at:629:703; Interrogation_Position=1763; Antisense; TTAGTCACGGTATATGCACGCGATA
>probe:Drosophila_2:1637894_at:338:239; Interrogation_Position=1787; Antisense; AATAAGGCGGGCACGCTCCCAAAAG
>probe:Drosophila_2:1637894_at:469:573; Interrogation_Position=1813; Antisense; GGCGTGGCACCGGTGAACAAAACAC
>probe:Drosophila_2:1637894_at:554:235; Interrogation_Position=1846; Antisense; AATCGAATTACACATGGAGGCCATT
>probe:Drosophila_2:1637894_at:82:71; Interrogation_Position=1863; Antisense; AGGCCATTGTTCGACTCTTTTTGAC
>probe:Drosophila_2:1637894_at:124:665; Interrogation_Position=1989; Antisense; TACACCCAGAACAATGCTAAATGCT

Paste this into a BLAST search page for me
AGTCGCAGGACCAGTCGCTGATCACGCTGATCACCAACATCACCACGAATGAGAGCGTTACCGTCGAGATCATCGTCATCGAGCCGGGTCAGAAGTAAGGGATGGCTACTTCGAGCACAAAGCTTGCACAAAGCTTGATTTTGCATTGGAGATTAACTGGCTAACTCTCTGACACAACTCTCTGACACACGACAACAGGATTAGTCACGGTATATGCACGCGATAAATAAGGCGGGCACGCTCCCAAAAGGGCGTGGCACCGGTGAACAAAACACAATCGAATTACACATGGAGGCCATTAGGCCATTGTTCGACTCTTTTTGACTACACCCAGAACAATGCTAAATGCT

Full Affymetrix probeset data:

Annotations for 1637894_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime