Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637895_at:

>probe:Drosophila_2:1637895_at:313:503; Interrogation_Position=11806; Antisense; GTCCTACCCATTGATTCGCTGAAGA
>probe:Drosophila_2:1637895_at:482:403; Interrogation_Position=11869; Antisense; GACTTCTTTGAGATGCACACCAACA
>probe:Drosophila_2:1637895_at:116:565; Interrogation_Position=11928; Antisense; GGAATGCACCGATGCCATCATCAAT
>probe:Drosophila_2:1637895_at:313:367; Interrogation_Position=11960; Antisense; GAATCTTCATCGAAGCAGCTCGCTG
>probe:Drosophila_2:1637895_at:463:169; Interrogation_Position=11995; Antisense; AAAGGCGGCCTGTGCGATGCCAACT
>probe:Drosophila_2:1637895_at:430:631; Interrogation_Position=12034; Antisense; TCCCGAATGCCGGTGGTGAGGTTCA
>probe:Drosophila_2:1637895_at:579:539; Interrogation_Position=12053; Antisense; GGTTCAAGCCGTGCCTGGAGATTTC
>probe:Drosophila_2:1637895_at:119:551; Interrogation_Position=12069; Antisense; GGAGATTTCTCCGACGGTGCGATAT
>probe:Drosophila_2:1637895_at:354:57; Interrogation_Position=12092; Antisense; ATGAGGCGCCGCTGTACAAGACCCA
>probe:Drosophila_2:1637895_at:431:213; Interrogation_Position=12109; Antisense; AAGACCCAGCAGAGATCCGGTGTCC
>probe:Drosophila_2:1637895_at:586:521; Interrogation_Position=12144; Antisense; GGGCCATTCGACGAACTTCATCTTG
>probe:Drosophila_2:1637895_at:179:591; Interrogation_Position=12227; Antisense; TGGTTTCCGCTGTGCTCGAAAATAT
>probe:Drosophila_2:1637895_at:649:621; Interrogation_Position=12297; Antisense; TGCTGCATACTTAAAGCCGTCTTTA
>probe:Drosophila_2:1637895_at:62:125; Interrogation_Position=12311; Antisense; AGCCGTCTTTATTTCGTTTCATGTT

Paste this into a BLAST search page for me
GTCCTACCCATTGATTCGCTGAAGAGACTTCTTTGAGATGCACACCAACAGGAATGCACCGATGCCATCATCAATGAATCTTCATCGAAGCAGCTCGCTGAAAGGCGGCCTGTGCGATGCCAACTTCCCGAATGCCGGTGGTGAGGTTCAGGTTCAAGCCGTGCCTGGAGATTTCGGAGATTTCTCCGACGGTGCGATATATGAGGCGCCGCTGTACAAGACCCAAAGACCCAGCAGAGATCCGGTGTCCGGGCCATTCGACGAACTTCATCTTGTGGTTTCCGCTGTGCTCGAAAATATTGCTGCATACTTAAAGCCGTCTTTAAGCCGTCTTTATTTCGTTTCATGTT

Full Affymetrix probeset data:

Annotations for 1637895_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime