Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637896_at:

>probe:Drosophila_2:1637896_at:247:253; Interrogation_Position=11156; Antisense; CAACCTTCTGGCTGTCTGGATTCTT
>probe:Drosophila_2:1637896_at:421:599; Interrogation_Position=11168; Antisense; TGTCTGGATTCTTCTTCACGCAGGC
>probe:Drosophila_2:1637896_at:324:323; Interrogation_Position=11204; Antisense; GCGCCATGCAGAACTTTGCCCGAAA
>probe:Drosophila_2:1637896_at:660:393; Interrogation_Position=11225; Antisense; GAAAGTACAAGATCCCCATCGACAC
>probe:Drosophila_2:1637896_at:179:135; Interrogation_Position=11248; Antisense; ACGCTGACCTTTGACTACGATGTGC
>probe:Drosophila_2:1637896_at:729:421; Interrogation_Position=11281; Antisense; GAGACAAAGACTTCGCCTCCGGACG
>probe:Drosophila_2:1637896_at:725:669; Interrogation_Position=11314; Antisense; TACTGCAACGGACTGTACCTGGAGG
>probe:Drosophila_2:1637896_at:49:341; Interrogation_Position=11367; Antisense; GCTAGTAGAGCAGTTCCCCAAGGTG
>probe:Drosophila_2:1637896_at:290:49; Interrogation_Position=11404; Antisense; ATGCCCGTGATCTTTTTCCGACCTG
>probe:Drosophila_2:1637896_at:486:359; Interrogation_Position=11492; Antisense; GCAAGGGAACGCTGTCCACGACAGG
>probe:Drosophila_2:1637896_at:327:399; Interrogation_Position=11511; Antisense; GACAGGTCACTCCACAAACTACGTG
>probe:Drosophila_2:1637896_at:301:671; Interrogation_Position=11530; Antisense; TACGTGGTCCCTCTGCTGTTGAACA
>probe:Drosophila_2:1637896_at:682:385; Interrogation_Position=11550; Antisense; GAACACGCATGTTAAGGCATCCCAC
>probe:Drosophila_2:1637896_at:150:413; Interrogation_Position=11607; Antisense; GACCAGCGACTGAGCTCTATTGGGA

Paste this into a BLAST search page for me
CAACCTTCTGGCTGTCTGGATTCTTTGTCTGGATTCTTCTTCACGCAGGCGCGCCATGCAGAACTTTGCCCGAAAGAAAGTACAAGATCCCCATCGACACACGCTGACCTTTGACTACGATGTGCGAGACAAAGACTTCGCCTCCGGACGTACTGCAACGGACTGTACCTGGAGGGCTAGTAGAGCAGTTCCCCAAGGTGATGCCCGTGATCTTTTTCCGACCTGGCAAGGGAACGCTGTCCACGACAGGGACAGGTCACTCCACAAACTACGTGTACGTGGTCCCTCTGCTGTTGAACAGAACACGCATGTTAAGGCATCCCACGACCAGCGACTGAGCTCTATTGGGA

Full Affymetrix probeset data:

Annotations for 1637896_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime