FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637897_at:

>probe:Drosophila_2:1637897_at:315:183; Interrogation_Position=3758; Antisense; AAAAGCACAGCGATCGTGACCGCGA
>probe:Drosophila_2:1637897_at:27:639; Interrogation_Position=3771; Antisense; TCGTGACCGCGACAAGGAGAGCAAA
>probe:Drosophila_2:1637897_at:348:415; Interrogation_Position=3804; Antisense; GAGCCAAGACTACGCGAAGTACAAT
>probe:Drosophila_2:1637897_at:25:229; Interrogation_Position=3826; Antisense; AATGGCGCTGGTGGCGGCATCTTTA
>probe:Drosophila_2:1637897_at:283:37; Interrogation_Position=3844; Antisense; ATCTTTAATCCCCTTGGCGGTGCTG
>probe:Drosophila_2:1637897_at:684:581; Interrogation_Position=3867; Antisense; TGGCGCCGCACCCAATATGTCTGGA
>probe:Drosophila_2:1637897_at:289:25; Interrogation_Position=3881; Antisense; ATATGTCTGGAGGAATGGGCGCCCC
>probe:Drosophila_2:1637897_at:181:601; Interrogation_Position=3918; Antisense; TGTACCACCATCCATGCTGTTGGCG
>probe:Drosophila_2:1637897_at:532:485; Interrogation_Position=4017; Antisense; GTAGCGGTCAGAGGGTTATTCTTAA
>probe:Drosophila_2:1637897_at:487:379; Interrogation_Position=4066; Antisense; GAACCTCAGTAAGTCCGATTGTAGT
>probe:Drosophila_2:1637897_at:334:85; Interrogation_Position=4163; Antisense; AGTGAAACCGGATGCGCAGATCGAA
>probe:Drosophila_2:1637897_at:126:173; Interrogation_Position=4226; Antisense; AAAGCAGTACTCAAATCGCGAAAAC
>probe:Drosophila_2:1637897_at:531:299; Interrogation_Position=4242; Antisense; CGCGAAAACTTTTGTACAGCATTAA
>probe:Drosophila_2:1637897_at:299:345; Interrogation_Position=4290; Antisense; GCATACATATAAGCCCACATACATA

Paste this into a BLAST search page for me
AAAAGCACAGCGATCGTGACCGCGATCGTGACCGCGACAAGGAGAGCAAAGAGCCAAGACTACGCGAAGTACAATAATGGCGCTGGTGGCGGCATCTTTAATCTTTAATCCCCTTGGCGGTGCTGTGGCGCCGCACCCAATATGTCTGGAATATGTCTGGAGGAATGGGCGCCCCTGTACCACCATCCATGCTGTTGGCGGTAGCGGTCAGAGGGTTATTCTTAAGAACCTCAGTAAGTCCGATTGTAGTAGTGAAACCGGATGCGCAGATCGAAAAAGCAGTACTCAAATCGCGAAAACCGCGAAAACTTTTGTACAGCATTAAGCATACATATAAGCCCACATACATA

Full Affymetrix probeset data:

Annotations for 1637897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720