Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637899_at:

>probe:Drosophila_2:1637899_at:716:169; Interrogation_Position=1166; Antisense; AAAGGAGCTGTGAAACCGCTCTCCC
>probe:Drosophila_2:1637899_at:107:475; Interrogation_Position=1195; Antisense; GTTAGCAACACCTCTTAACATGCCG
>probe:Drosophila_2:1637899_at:603:97; Interrogation_Position=1240; Antisense; AGATCCGCGATCTGAGCTTATGGCC
>probe:Drosophila_2:1637899_at:357:679; Interrogation_Position=1258; Antisense; TATGGCCGCCATAAGAAACGCCGGT
>probe:Drosophila_2:1637899_at:683:319; Interrogation_Position=1321; Antisense; GCCGCTCGACGTGGTGGACAACAGT
>probe:Drosophila_2:1637899_at:578:397; Interrogation_Position=1337; Antisense; GACAACAGTCGCTCCAAGGCGGGAG
>probe:Drosophila_2:1637899_at:141:585; Interrogation_Position=1383; Antisense; TGGCAGACCTGCATAACAAGCTAAT
>probe:Drosophila_2:1637899_at:127:621; Interrogation_Position=1407; Antisense; TGCTGCGACGCAAGGGAATTTCTGG
>probe:Drosophila_2:1637899_at:431:127; Interrogation_Position=1433; Antisense; AGCCAGAATCCCGTGGAGGCCACTG
>probe:Drosophila_2:1637899_at:14:313; Interrogation_Position=1510; Antisense; GCCCCGCAAGGGATCTAAGTCGAGT
>probe:Drosophila_2:1637899_at:194:669; Interrogation_Position=1588; Antisense; TAGTACCGGTTTAAGTGCCTTGGCT
>probe:Drosophila_2:1637899_at:485:625; Interrogation_Position=1603; Antisense; TGCCTTGGCTGGCTTAAAGCACTAG
>probe:Drosophila_2:1637899_at:359:107; Interrogation_Position=1626; Antisense; AGCAACCTAGGTTCTCTAGCTTAAA
>probe:Drosophila_2:1637899_at:373:245; Interrogation_Position=1671; Antisense; AATTCCAAATTCTGTGCCCAAGCGA

Paste this into a BLAST search page for me
AAAGGAGCTGTGAAACCGCTCTCCCGTTAGCAACACCTCTTAACATGCCGAGATCCGCGATCTGAGCTTATGGCCTATGGCCGCCATAAGAAACGCCGGTGCCGCTCGACGTGGTGGACAACAGTGACAACAGTCGCTCCAAGGCGGGAGTGGCAGACCTGCATAACAAGCTAATTGCTGCGACGCAAGGGAATTTCTGGAGCCAGAATCCCGTGGAGGCCACTGGCCCCGCAAGGGATCTAAGTCGAGTTAGTACCGGTTTAAGTGCCTTGGCTTGCCTTGGCTGGCTTAAAGCACTAGAGCAACCTAGGTTCTCTAGCTTAAAAATTCCAAATTCTGTGCCCAAGCGA

Full Affymetrix probeset data:

Annotations for 1637899_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime