Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637900_at:

>probe:Drosophila_2:1637900_at:307:447; Interrogation_Position=450; Antisense; GATCCTTTCCCAAGATCGTGCTGAA
>probe:Drosophila_2:1637900_at:283:449; Interrogation_Position=538; Antisense; GATCGTGTTGCACAATCCCAAGTTT
>probe:Drosophila_2:1637900_at:64:411; Interrogation_Position=600; Antisense; GACGCACCTACCTGAGCGTGGATAA
>probe:Drosophila_2:1637900_at:173:551; Interrogation_Position=667; Antisense; GGAGAACCTCTTTAATGGCGACCAG
>probe:Drosophila_2:1637900_at:591:3; Interrogation_Position=694; Antisense; ATTGGGCACCAATCTGAATCAGTTC
>probe:Drosophila_2:1637900_at:333:435; Interrogation_Position=737; Antisense; GAGGTGTGGAACGAGCTGCATCCCT
>probe:Drosophila_2:1637900_at:260:37; Interrogation_Position=785; Antisense; ATCATGAAGAGCGTTCTCTCGCAGC
>probe:Drosophila_2:1637900_at:405:205; Interrogation_Position=815; Antisense; AAGCGCTTCGCCTACGAGGATTTAT
>probe:Drosophila_2:1637900_at:315:423; Interrogation_Position=845; Antisense; GAGAACTGAGCACTAGTCGTCCTAG
>probe:Drosophila_2:1637900_at:660:69; Interrogation_Position=878; Antisense; AGGCGCCCTAGGACTTTAGGCTAAG
>probe:Drosophila_2:1637900_at:371:515; Interrogation_Position=902; Antisense; GTGTACGAGTATTTCCTCACCTATC
>probe:Drosophila_2:1637900_at:601:683; Interrogation_Position=923; Antisense; TATCCAAGCTATTCTCACTCACATG
>probe:Drosophila_2:1637900_at:691:577; Interrogation_Position=970; Antisense; GGCCATTGACACATCATCATCGTAT
>probe:Drosophila_2:1637900_at:714:41; Interrogation_Position=988; Antisense; ATCGTATCATCGTATCTGCTAAGCT

Paste this into a BLAST search page for me
GATCCTTTCCCAAGATCGTGCTGAAGATCGTGTTGCACAATCCCAAGTTTGACGCACCTACCTGAGCGTGGATAAGGAGAACCTCTTTAATGGCGACCAGATTGGGCACCAATCTGAATCAGTTCGAGGTGTGGAACGAGCTGCATCCCTATCATGAAGAGCGTTCTCTCGCAGCAAGCGCTTCGCCTACGAGGATTTATGAGAACTGAGCACTAGTCGTCCTAGAGGCGCCCTAGGACTTTAGGCTAAGGTGTACGAGTATTTCCTCACCTATCTATCCAAGCTATTCTCACTCACATGGGCCATTGACACATCATCATCGTATATCGTATCATCGTATCTGCTAAGCT

Full Affymetrix probeset data:

Annotations for 1637900_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime