FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637901_at:

>probe:Drosophila_2:1637901_at:435:619; Interrogation_Position=117; Antisense; TGCTATTCGCAATTATCTCAGGAGT
>probe:Drosophila_2:1637901_at:570:17; Interrogation_Position=145; Antisense; ATTTGCCAGGCATGGTCATTGGACC
>probe:Drosophila_2:1637901_at:261:3; Interrogation_Position=162; Antisense; ATTGGACCGCCTTGGTTGCACTGAT
>probe:Drosophila_2:1637901_at:496:355; Interrogation_Position=179; Antisense; GCACTGATCTTCACCATTTTCTGGA
>probe:Drosophila_2:1637901_at:579:67; Interrogation_Position=224; Antisense; ATGGCGGGTATCTATAGGCGAAAAC
>probe:Drosophila_2:1637901_at:659:177; Interrogation_Position=245; Antisense; AAACTGGGACTGGTACGATTCTGGT
>probe:Drosophila_2:1637901_at:320:139; Interrogation_Position=259; Antisense; ACGATTCTGGTTGGTGTTCACCTGC
>probe:Drosophila_2:1637901_at:479:473; Interrogation_Position=274; Antisense; GTTCACCTGCTTGGGAATACTTCTA
>probe:Drosophila_2:1637901_at:592:441; Interrogation_Position=299; Antisense; GATGGATTTATACTGCTCTACGGCC
>probe:Drosophila_2:1637901_at:599:413; Interrogation_Position=325; Antisense; GACCTTGGCCATATCTGTGAACTGG
>probe:Drosophila_2:1637901_at:417:185; Interrogation_Position=359; Antisense; AAAATCACAGTGCTGCCCTTCGTAG
>probe:Drosophila_2:1637901_at:169:265; Interrogation_Position=375; Antisense; CCTTCGTAGGACTGGCCGTGGAAAT
>probe:Drosophila_2:1637901_at:186:189; Interrogation_Position=454; Antisense; AACAGAAACGCCTCCCGATGAGAAG
>probe:Drosophila_2:1637901_at:394:175; Interrogation_Position=526; Antisense; AAAGCCACTGGATCGCAAGGATCTG

Paste this into a BLAST search page for me
TGCTATTCGCAATTATCTCAGGAGTATTTGCCAGGCATGGTCATTGGACCATTGGACCGCCTTGGTTGCACTGATGCACTGATCTTCACCATTTTCTGGAATGGCGGGTATCTATAGGCGAAAACAAACTGGGACTGGTACGATTCTGGTACGATTCTGGTTGGTGTTCACCTGCGTTCACCTGCTTGGGAATACTTCTAGATGGATTTATACTGCTCTACGGCCGACCTTGGCCATATCTGTGAACTGGAAAATCACAGTGCTGCCCTTCGTAGCCTTCGTAGGACTGGCCGTGGAAATAACAGAAACGCCTCCCGATGAGAAGAAAGCCACTGGATCGCAAGGATCTG

Full Affymetrix probeset data:

Annotations for 1637901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720