Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637902_at:

>probe:Drosophila_2:1637902_at:74:291; Interrogation_Position=111; Antisense; CGGTGGCCGAAGTCTTGGAGGATTC
>probe:Drosophila_2:1637902_at:11:53; Interrogation_Position=13; Antisense; ATGCGTGCCTACATTGCAATTACCC
>probe:Drosophila_2:1637902_at:660:517; Interrogation_Position=170; Antisense; GTGGTCCTGGTGGTACTGGTGGCCC
>probe:Drosophila_2:1637902_at:341:275; Interrogation_Position=201; Antisense; CTTCGGCGGACCTGGTCGCTTTGGA
>probe:Drosophila_2:1637902_at:551:3; Interrogation_Position=25; Antisense; ATTGCAATTACCCTGCTGGCCCTGG
>probe:Drosophila_2:1637902_at:156:717; Interrogation_Position=275; Antisense; TTGGCGGTCCCGGAAGCTTCAATGG
>probe:Drosophila_2:1637902_at:580:283; Interrogation_Position=285; Antisense; CGGAAGCTTCAATGGTGGATTCGGC
>probe:Drosophila_2:1637902_at:262:637; Interrogation_Position=342; Antisense; TCGTCGCCCAAGACCTTGGTGGACG
>probe:Drosophila_2:1637902_at:390:129; Interrogation_Position=354; Antisense; ACCTTGGTGGACGACAACGGAGAGT
>probe:Drosophila_2:1637902_at:437:159; Interrogation_Position=367; Antisense; ACAACGGAGAGTTCCTTGGCCGACA
>probe:Drosophila_2:1637902_at:719:305; Interrogation_Position=45; Antisense; CCTGGTGGCAGTTGTCGTGGCCCAA
>probe:Drosophila_2:1637902_at:532:131; Interrogation_Position=511; Antisense; ACCGATAGCTCCACTGATAGCAGCT
>probe:Drosophila_2:1637902_at:594:307; Interrogation_Position=521; Antisense; CCACTGATAGCAGCTCCACGGAGAG
>probe:Drosophila_2:1637902_at:1:141; Interrogation_Position=538; Antisense; ACGGAGAGCACTACTGGTTCGGGAT

Paste this into a BLAST search page for me
CGGTGGCCGAAGTCTTGGAGGATTCATGCGTGCCTACATTGCAATTACCCGTGGTCCTGGTGGTACTGGTGGCCCCTTCGGCGGACCTGGTCGCTTTGGAATTGCAATTACCCTGCTGGCCCTGGTTGGCGGTCCCGGAAGCTTCAATGGCGGAAGCTTCAATGGTGGATTCGGCTCGTCGCCCAAGACCTTGGTGGACGACCTTGGTGGACGACAACGGAGAGTACAACGGAGAGTTCCTTGGCCGACACCTGGTGGCAGTTGTCGTGGCCCAAACCGATAGCTCCACTGATAGCAGCTCCACTGATAGCAGCTCCACGGAGAGACGGAGAGCACTACTGGTTCGGGAT

Full Affymetrix probeset data:

Annotations for 1637902_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime