FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637904_at:

>probe:Drosophila_2:1637904_at:552:333; Interrogation_Position=171; Antisense; GCTGGTCGACAGGAGTGCTTTTATC
>probe:Drosophila_2:1637904_at:520:85; Interrogation_Position=184; Antisense; AGTGCTTTTATCAGCCGATTGCCAC
>probe:Drosophila_2:1637904_at:623:293; Interrogation_Position=199; Antisense; CGATTGCCACCACCGAGAACATTAA
>probe:Drosophila_2:1637904_at:373:641; Interrogation_Position=251; Antisense; TCTCGGCGAGACACACATCAATTTT
>probe:Drosophila_2:1637904_at:389:219; Interrogation_Position=290; Antisense; AAGTCGTCGACTTCTGATAGCAGAA
>probe:Drosophila_2:1637904_at:378:707; Interrogation_Position=421; Antisense; TTACTCTTGAAGTAGCTCCGGCCGA
>probe:Drosophila_2:1637904_at:288:565; Interrogation_Position=458; Antisense; GGAATTGCGTGATCTTCGCCAGGAA
>probe:Drosophila_2:1637904_at:255:15; Interrogation_Position=483; Antisense; ATGTTAACCGACTACCACTTTGACG
>probe:Drosophila_2:1637904_at:257:695; Interrogation_Position=502; Antisense; TTGACGTGGCCTATACTGGTATCGA
>probe:Drosophila_2:1637904_at:624:379; Interrogation_Position=551; Antisense; GAACCTCATGAGATCGCGTCAAACT
>probe:Drosophila_2:1637904_at:179:175; Interrogation_Position=571; Antisense; AAACTCAGGACTTCATTCGAGCGAT
>probe:Drosophila_2:1637904_at:297:495; Interrogation_Position=639; Antisense; GTCAACAAATGGTCGTGGGCCCAAT
>probe:Drosophila_2:1637904_at:168:523; Interrogation_Position=655; Antisense; GGGCCCAATTTTTGTCCATGATATT
>probe:Drosophila_2:1637904_at:360:571; Interrogation_Position=684; Antisense; GGCTTTCTACAGGTCTTGATGGTCA

Paste this into a BLAST search page for me
GCTGGTCGACAGGAGTGCTTTTATCAGTGCTTTTATCAGCCGATTGCCACCGATTGCCACCACCGAGAACATTAATCTCGGCGAGACACACATCAATTTTAAGTCGTCGACTTCTGATAGCAGAATTACTCTTGAAGTAGCTCCGGCCGAGGAATTGCGTGATCTTCGCCAGGAAATGTTAACCGACTACCACTTTGACGTTGACGTGGCCTATACTGGTATCGAGAACCTCATGAGATCGCGTCAAACTAAACTCAGGACTTCATTCGAGCGATGTCAACAAATGGTCGTGGGCCCAATGGGCCCAATTTTTGTCCATGATATTGGCTTTCTACAGGTCTTGATGGTCA

Full Affymetrix probeset data:

Annotations for 1637904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720