FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637907_at:

>probe:Drosophila_2:1637907_at:204:527; Interrogation_Position=501; Antisense; GGGACTCCGTCTGTTCATCGGCAGT
>probe:Drosophila_2:1637907_at:573:405; Interrogation_Position=503; Antisense; GACTCCGTCTGTTCATCGGCAGTGG
>probe:Drosophila_2:1637907_at:202:633; Interrogation_Position=506; Antisense; TCCGTCTGTTCATCGGCAGTGGCAC
>probe:Drosophila_2:1637907_at:3:641; Interrogation_Position=510; Antisense; TCTGTTCATCGGCAGTGGCACCAAT
>probe:Drosophila_2:1637907_at:307:603; Interrogation_Position=512; Antisense; TGTTCATCGGCAGTGGCACCAATCA
>probe:Drosophila_2:1637907_at:607:713; Interrogation_Position=514; Antisense; TTCATCGGCAGTGGCACCAATCACT
>probe:Drosophila_2:1637907_at:483:41; Interrogation_Position=517; Antisense; ATCGGCAGTGGCACCAATCACTACT
>probe:Drosophila_2:1637907_at:550:639; Interrogation_Position=518; Antisense; TCGGCAGTGGCACCAATCACTACTC
>probe:Drosophila_2:1637907_at:639:605; Interrogation_Position=597; Antisense; TGACTACAAGGACGAACAGGGCCGA
>probe:Drosophila_2:1637907_at:728:553; Interrogation_Position=601; Antisense; TACAAGGACGAACAGGGCCGACCGA
>probe:Drosophila_2:1637907_at:161:251; Interrogation_Position=603; Antisense; CAAGGACGAACAGGGCCGACCGATA
>probe:Drosophila_2:1637907_at:333:135; Interrogation_Position=608; Antisense; ACGAACAGGGCCGACCGATATATAA
>probe:Drosophila_2:1637907_at:545:385; Interrogation_Position=610; Antisense; GAACAGGGCCGACCGATATATAATC
>probe:Drosophila_2:1637907_at:146:153; Interrogation_Position=612; Antisense; ACAGGGCCGACCGATATATAATCCA

Paste this into a BLAST search page for me
GGGACTCCGTCTGTTCATCGGCAGTGACTCCGTCTGTTCATCGGCAGTGGTCCGTCTGTTCATCGGCAGTGGCACTCTGTTCATCGGCAGTGGCACCAATTGTTCATCGGCAGTGGCACCAATCATTCATCGGCAGTGGCACCAATCACTATCGGCAGTGGCACCAATCACTACTTCGGCAGTGGCACCAATCACTACTCTGACTACAAGGACGAACAGGGCCGATACAAGGACGAACAGGGCCGACCGACAAGGACGAACAGGGCCGACCGATAACGAACAGGGCCGACCGATATATAAGAACAGGGCCGACCGATATATAATCACAGGGCCGACCGATATATAATCCA

Full Affymetrix probeset data:

Annotations for 1637907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720