FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637909_at:

>probe:Drosophila_2:1637909_at:236:129; Interrogation_Position=252; Antisense; ACCAGCGTCCAATTACCTATTTCTT
>probe:Drosophila_2:1637909_at:138:521; Interrogation_Position=286; Antisense; GTGGACCGCGGCAAACAATCTATCG
>probe:Drosophila_2:1637909_at:169:239; Interrogation_Position=302; Antisense; AATCTATCGAGACCATGTGCCTATT
>probe:Drosophila_2:1637909_at:589:597; Interrogation_Position=317; Antisense; TGTGCCTATTGCTGGCCTATAAAAT
>probe:Drosophila_2:1637909_at:378:59; Interrogation_Position=380; Antisense; ATGATTGCATGCCAGTTTCCGCCAT
>probe:Drosophila_2:1637909_at:514:243; Interrogation_Position=417; Antisense; AATATTTTGTTGTCACGGCGGTCTC
>probe:Drosophila_2:1637909_at:353:3; Interrogation_Position=469; Antisense; ATTGGACAATTAGCCCGACCATGTG
>probe:Drosophila_2:1637909_at:648:413; Interrogation_Position=485; Antisense; GACCATGTGACGTTCCTGACAAGGG
>probe:Drosophila_2:1637909_at:32:1; Interrogation_Position=506; Antisense; AGGGTTTACTTTGCGACCTCCTATG
>probe:Drosophila_2:1637909_at:419:527; Interrogation_Position=530; Antisense; GGTCAGACCCCGATCCAAAGATAAT
>probe:Drosophila_2:1637909_at:68:293; Interrogation_Position=570; Antisense; CGATCGAGGCGTCAGTGTTACTTTT
>probe:Drosophila_2:1637909_at:602:525; Interrogation_Position=609; Antisense; GGGAAAGTTTGTGCACCGTCATAAA
>probe:Drosophila_2:1637909_at:472:243; Interrogation_Position=632; Antisense; AATTTGATCTCATTTGCCGTGCACA
>probe:Drosophila_2:1637909_at:293:229; Interrogation_Position=780; Antisense; AATGTGCTCGTTCTACGTCCTTAAA

Paste this into a BLAST search page for me
ACCAGCGTCCAATTACCTATTTCTTGTGGACCGCGGCAAACAATCTATCGAATCTATCGAGACCATGTGCCTATTTGTGCCTATTGCTGGCCTATAAAATATGATTGCATGCCAGTTTCCGCCATAATATTTTGTTGTCACGGCGGTCTCATTGGACAATTAGCCCGACCATGTGGACCATGTGACGTTCCTGACAAGGGAGGGTTTACTTTGCGACCTCCTATGGGTCAGACCCCGATCCAAAGATAATCGATCGAGGCGTCAGTGTTACTTTTGGGAAAGTTTGTGCACCGTCATAAAAATTTGATCTCATTTGCCGTGCACAAATGTGCTCGTTCTACGTCCTTAAA

Full Affymetrix probeset data:

Annotations for 1637909_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720