Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637910_at:

>probe:Drosophila_2:1637910_at:448:527; Interrogation_Position=1232; Antisense; GGGAGCCACCTATCATAAATGTCGA
>probe:Drosophila_2:1637910_at:254:679; Interrogation_Position=1269; Antisense; TAGTGGCCTGCATATTCTTACCGAA
>probe:Drosophila_2:1637910_at:679:95; Interrogation_Position=1293; Antisense; AGATCCGACAATTCTACAAGCCTTC
>probe:Drosophila_2:1637910_at:573:71; Interrogation_Position=1319; Antisense; AGGAAAATATTTTGCCCAGCTCGTT
>probe:Drosophila_2:1637910_at:626:117; Interrogation_Position=1336; Antisense; AGCTCGTTGGCGGATCTGGTGATTC
>probe:Drosophila_2:1637910_at:711:211; Interrogation_Position=1370; Antisense; AAGACACTTATTTCCATCACGTCAC
>probe:Drosophila_2:1637910_at:638:187; Interrogation_Position=1405; Antisense; AACAGCTACGTCTATGTGGTGCAAG
>probe:Drosophila_2:1637910_at:597:437; Interrogation_Position=1498; Antisense; GAGGAACTCTGCTCCAAATGGCGTA
>probe:Drosophila_2:1637910_at:245:169; Interrogation_Position=1513; Antisense; AAATGGCGTATCTTGGGCATCCCGC
>probe:Drosophila_2:1637910_at:270:297; Interrogation_Position=1535; Antisense; CGCTGAATCCGAAATCACCTCTAAG
>probe:Drosophila_2:1637910_at:105:625; Interrogation_Position=1667; Antisense; TGCCCGTTGACTCCGTAGATAGTTG
>probe:Drosophila_2:1637910_at:466:677; Interrogation_Position=1682; Antisense; TAGATAGTTGGCAACCGCTGTCCAT
>probe:Drosophila_2:1637910_at:585:679; Interrogation_Position=1742; Antisense; TAGGATTAGTGATCGCCACCTTGGC
>probe:Drosophila_2:1637910_at:423:471; Interrogation_Position=1767; Antisense; GTTCGTTGCTGAACTGCTTCACAAT

Paste this into a BLAST search page for me
GGGAGCCACCTATCATAAATGTCGATAGTGGCCTGCATATTCTTACCGAAAGATCCGACAATTCTACAAGCCTTCAGGAAAATATTTTGCCCAGCTCGTTAGCTCGTTGGCGGATCTGGTGATTCAAGACACTTATTTCCATCACGTCACAACAGCTACGTCTATGTGGTGCAAGGAGGAACTCTGCTCCAAATGGCGTAAAATGGCGTATCTTGGGCATCCCGCCGCTGAATCCGAAATCACCTCTAAGTGCCCGTTGACTCCGTAGATAGTTGTAGATAGTTGGCAACCGCTGTCCATTAGGATTAGTGATCGCCACCTTGGCGTTCGTTGCTGAACTGCTTCACAAT

Full Affymetrix probeset data:

Annotations for 1637910_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime