FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637911_at:

>probe:Drosophila_2:1637911_at:332:521; Interrogation_Position=1006; Antisense; GTGGAACTGCCACCAGCAATGGACC
>probe:Drosophila_2:1637911_at:621:535; Interrogation_Position=1049; Antisense; GGTCCCGGAGGCTATGTCCAAACAG
>probe:Drosophila_2:1637911_at:77:267; Interrogation_Position=1142; Antisense; CAGTTCGTGCAACAGAGTCTGCTAT
>probe:Drosophila_2:1637911_at:720:619; Interrogation_Position=1161; Antisense; TGCTATCCTCTTCGGCGGATGAGAA
>probe:Drosophila_2:1637911_at:700:559; Interrogation_Position=1186; Antisense; GGAAATCCTGCCCATTGCAGATCTA
>probe:Drosophila_2:1637911_at:666:445; Interrogation_Position=1226; Antisense; GATGCGAATCGCACGCTTGTCGGTG
>probe:Drosophila_2:1637911_at:610:113; Interrogation_Position=1260; Antisense; AGCAGCTTGCTTGGGATCCGCATGG
>probe:Drosophila_2:1637911_at:62:547; Interrogation_Position=1273; Antisense; GGATCCGCATGGCAATTATCTGGTA
>probe:Drosophila_2:1637911_at:155:681; Interrogation_Position=1289; Antisense; TATCTGGTAGTCACATTCAAGGCGA
>probe:Drosophila_2:1637911_at:613:93; Interrogation_Position=1350; Antisense; AGTTCGATCTGCAGATTTCGGCGGC
>probe:Drosophila_2:1637911_at:84:19; Interrogation_Position=1364; Antisense; ATTTCGGCGGCTTACTATCTGAGCG
>probe:Drosophila_2:1637911_at:390:343; Interrogation_Position=1422; Antisense; GCTTCCAGCCACTCTACGAGGATAA
>probe:Drosophila_2:1637911_at:595:435; Interrogation_Position=1439; Antisense; GAGGATAACGATCGCTCCGTGCTGA
>probe:Drosophila_2:1637911_at:399:665; Interrogation_Position=1493; Antisense; TACTACGCCTTCGACTGATCTTAAA

Paste this into a BLAST search page for me
GTGGAACTGCCACCAGCAATGGACCGGTCCCGGAGGCTATGTCCAAACAGCAGTTCGTGCAACAGAGTCTGCTATTGCTATCCTCTTCGGCGGATGAGAAGGAAATCCTGCCCATTGCAGATCTAGATGCGAATCGCACGCTTGTCGGTGAGCAGCTTGCTTGGGATCCGCATGGGGATCCGCATGGCAATTATCTGGTATATCTGGTAGTCACATTCAAGGCGAAGTTCGATCTGCAGATTTCGGCGGCATTTCGGCGGCTTACTATCTGAGCGGCTTCCAGCCACTCTACGAGGATAAGAGGATAACGATCGCTCCGTGCTGATACTACGCCTTCGACTGATCTTAAA

Full Affymetrix probeset data:

Annotations for 1637911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720