Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637913_at:

>probe:Drosophila_2:1637913_at:446:497; Interrogation_Position=1894; Antisense; GTCATAAGATTAGCGCCCCTGCATA
>probe:Drosophila_2:1637913_at:432:619; Interrogation_Position=1913; Antisense; TGCATAGCTCCGTTTCTTCTTATGT
>probe:Drosophila_2:1637913_at:174:283; Interrogation_Position=1920; Antisense; CTCCGTTTCTTCTTATGTTCTGTAT
>probe:Drosophila_2:1637913_at:719:685; Interrogation_Position=2038; Antisense; TTTCCAAACCTCTCGCTAAAACAGT
>probe:Drosophila_2:1637913_at:323:339; Interrogation_Position=2095; Antisense; GCTAACCTGGTGACGCGCAGTGTAT
>probe:Drosophila_2:1637913_at:32:513; Interrogation_Position=2104; Antisense; GTGACGCGCAGTGTATGTCTATATA
>probe:Drosophila_2:1637913_at:388:683; Interrogation_Position=2202; Antisense; TTACATCGATCTTTACGGGAAACTA
>probe:Drosophila_2:1637913_at:420:189; Interrogation_Position=2230; Antisense; AACTCCAATTTTAAATCGCTGTCTT
>probe:Drosophila_2:1637913_at:80:635; Interrogation_Position=2245; Antisense; TCGCTGTCTTTACCTATTCACCAAA
>probe:Drosophila_2:1637913_at:620:21; Interrogation_Position=2328; Antisense; ATATCCGTGGACTTATCCAACTTAG
>probe:Drosophila_2:1637913_at:218:401; Interrogation_Position=2376; Antisense; GACATATCATTGAAGACGCCTCTGT
>probe:Drosophila_2:1637913_at:431:103; Interrogation_Position=2389; Antisense; AGACGCCTCTGTAAATGTGTTTTTT
>probe:Drosophila_2:1637913_at:624:685; Interrogation_Position=2444; Antisense; TATACTTGTCAATCTATCCGTGAGT
>probe:Drosophila_2:1637913_at:405:235; Interrogation_Position=2454; Antisense; AATCTATCCGTGAGTTCCTTTAGCT

Paste this into a BLAST search page for me
GTCATAAGATTAGCGCCCCTGCATATGCATAGCTCCGTTTCTTCTTATGTCTCCGTTTCTTCTTATGTTCTGTATTTTCCAAACCTCTCGCTAAAACAGTGCTAACCTGGTGACGCGCAGTGTATGTGACGCGCAGTGTATGTCTATATATTACATCGATCTTTACGGGAAACTAAACTCCAATTTTAAATCGCTGTCTTTCGCTGTCTTTACCTATTCACCAAAATATCCGTGGACTTATCCAACTTAGGACATATCATTGAAGACGCCTCTGTAGACGCCTCTGTAAATGTGTTTTTTTATACTTGTCAATCTATCCGTGAGTAATCTATCCGTGAGTTCCTTTAGCT

Full Affymetrix probeset data:

Annotations for 1637913_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime