FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637914_at:

>probe:Drosophila_2:1637914_at:24:105; Interrogation_Position=122; Antisense; AGACTACGGCCAAGTTCCTGCTGAA
>probe:Drosophila_2:1637914_at:537:225; Interrogation_Position=145; Antisense; AAGGACCACGCCGACGCAGAGAAGG
>probe:Drosophila_2:1637914_at:553:635; Interrogation_Position=173; Antisense; TCGAGGAGTGCCGTGAGGACTACTA
>probe:Drosophila_2:1637914_at:179:73; Interrogation_Position=188; Antisense; AGGACTACTACGTGCCGGACGACAT
>probe:Drosophila_2:1637914_at:120:421; Interrogation_Position=217; Antisense; GAGAAGTACCTGAACTACGAGTTTC
>probe:Drosophila_2:1637914_at:312:109; Interrogation_Position=284; Antisense; AGAAGCTTGAGCTGTTCTCGGAGAA
>probe:Drosophila_2:1637914_at:326:223; Interrogation_Position=310; Antisense; AAGGGATTTGACGAGCGCGCCATGA
>probe:Drosophila_2:1637914_at:17:103; Interrogation_Position=353; Antisense; AGAGCAGCAAAGACCTGTCCACGGT
>probe:Drosophila_2:1637914_at:466:373; Interrogation_Position=393; Antisense; GAAGTGCATCGACCACAACGAGGCC
>probe:Drosophila_2:1637914_at:165:431; Interrogation_Position=418; Antisense; GAGTCGGATGTCTGCACCTGGGCCA
>probe:Drosophila_2:1637914_at:573:201; Interrogation_Position=472; Antisense; AACCGCCACGTGGTGCGTAAGGTCT
>probe:Drosophila_2:1637914_at:353:497; Interrogation_Position=493; Antisense; GTCTTCGCCTGACCTGAATGTGATA
>probe:Drosophila_2:1637914_at:117:505; Interrogation_Position=51; Antisense; GTCCGAGCCAGAAATGCAGTCCCAA
>probe:Drosophila_2:1637914_at:268:615; Interrogation_Position=93; Antisense; TGCAGCCGTTGCCACGTTTCTGGTG

Paste this into a BLAST search page for me
AGACTACGGCCAAGTTCCTGCTGAAAAGGACCACGCCGACGCAGAGAAGGTCGAGGAGTGCCGTGAGGACTACTAAGGACTACTACGTGCCGGACGACATGAGAAGTACCTGAACTACGAGTTTCAGAAGCTTGAGCTGTTCTCGGAGAAAAGGGATTTGACGAGCGCGCCATGAAGAGCAGCAAAGACCTGTCCACGGTGAAGTGCATCGACCACAACGAGGCCGAGTCGGATGTCTGCACCTGGGCCAAACCGCCACGTGGTGCGTAAGGTCTGTCTTCGCCTGACCTGAATGTGATAGTCCGAGCCAGAAATGCAGTCCCAATGCAGCCGTTGCCACGTTTCTGGTG

Full Affymetrix probeset data:

Annotations for 1637914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720