Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637916_at:

>probe:Drosophila_2:1637916_at:417:621; Interrogation_Position=1376; Antisense; TGCTGCCCAATGCTCAATTTATCAA
>probe:Drosophila_2:1637916_at:573:685; Interrogation_Position=1395; Antisense; TATCAATGTATTTCGCTGGCCAAAG
>probe:Drosophila_2:1637916_at:692:173; Interrogation_Position=1416; Antisense; AAAGCTCATTCTCCTTGGTTTGGGA
>probe:Drosophila_2:1637916_at:300:547; Interrogation_Position=1438; Antisense; GGAGTGGTGTCCTTTATCTTTTGCA
>probe:Drosophila_2:1637916_at:140:413; Interrogation_Position=1496; Antisense; GACCCCAGACCAATGTGATGCGAGT
>probe:Drosophila_2:1637916_at:696:277; Interrogation_Position=1554; Antisense; CTATAATGGCACGTTGACTCACAGT
>probe:Drosophila_2:1637916_at:304:529; Interrogation_Position=1584; Antisense; GGGATACTACTTCATATACCAGGAT
>probe:Drosophila_2:1637916_at:198:455; Interrogation_Position=1606; Antisense; GATAGACGCGGTCTGAGTCCGCTAA
>probe:Drosophila_2:1637916_at:149:107; Interrogation_Position=1697; Antisense; AGAAATCGGTTCTCCCGGATGGCAA
>probe:Drosophila_2:1637916_at:681:439; Interrogation_Position=1714; Antisense; GATGGCAAGACCACTCGATTTGAGT
>probe:Drosophila_2:1637916_at:140:587; Interrogation_Position=1749; Antisense; TGGACCGCCCCAAATGAACGTATTC
>probe:Drosophila_2:1637916_at:567:381; Interrogation_Position=1764; Antisense; GAACGTATTCATCCAGCCAGTGGGT
>probe:Drosophila_2:1637916_at:242:495; Interrogation_Position=1798; Antisense; GTCACGGATTGGACCTTCGATCGAA
>probe:Drosophila_2:1637916_at:78:69; Interrogation_Position=1871; Antisense; ATGGCATAGACGACAGTTCCCTGAA

Paste this into a BLAST search page for me
TGCTGCCCAATGCTCAATTTATCAATATCAATGTATTTCGCTGGCCAAAGAAAGCTCATTCTCCTTGGTTTGGGAGGAGTGGTGTCCTTTATCTTTTGCAGACCCCAGACCAATGTGATGCGAGTCTATAATGGCACGTTGACTCACAGTGGGATACTACTTCATATACCAGGATGATAGACGCGGTCTGAGTCCGCTAAAGAAATCGGTTCTCCCGGATGGCAAGATGGCAAGACCACTCGATTTGAGTTGGACCGCCCCAAATGAACGTATTCGAACGTATTCATCCAGCCAGTGGGTGTCACGGATTGGACCTTCGATCGAAATGGCATAGACGACAGTTCCCTGAA

Full Affymetrix probeset data:

Annotations for 1637916_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime