FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637919_at:

>probe:Drosophila_2:1637919_at:531:151; Interrogation_Position=125; Antisense; ACATCGAGACGTTTTGCTGCCTGTA
>probe:Drosophila_2:1637919_at:631:495; Interrogation_Position=15; Antisense; GTCATCTGGAGCATTAAATACCCTA
>probe:Drosophila_2:1637919_at:141:91; Interrogation_Position=170; Antisense; AGTTGGCCCTTAATCCAGGTATCTT
>probe:Drosophila_2:1637919_at:489:225; Interrogation_Position=226; Antisense; AAGGACTGCATTGAGCACTGCCAAT
>probe:Drosophila_2:1637919_at:588:355; Interrogation_Position=240; Antisense; GCACTGCCAATGCTCGAACAAGTCA
>probe:Drosophila_2:1637919_at:410:203; Interrogation_Position=277; Antisense; AAGCCCCGGATGGTGGTGTCTCTTC
>probe:Drosophila_2:1637919_at:637:497; Interrogation_Position=294; Antisense; GTCTCTTCTGGGAATGTTTGCCATG
>probe:Drosophila_2:1637919_at:506:241; Interrogation_Position=31; Antisense; AATACCCTAGCTATTGTCTTGCTCT
>probe:Drosophila_2:1637919_at:47:721; Interrogation_Position=311; Antisense; TTGCCATGCTAACCGAGTCGATCTA
>probe:Drosophila_2:1637919_at:722:391; Interrogation_Position=345; Antisense; GAAAGTTTGGGCAGGATGCGCTCTT
>probe:Drosophila_2:1637919_at:95:429; Interrogation_Position=395; Antisense; GAGTTGGTCGGCGACATGGCCACAA
>probe:Drosophila_2:1637919_at:208:645; Interrogation_Position=47; Antisense; TCTTGCTCTTGATGCCAGGTGCTTA
>probe:Drosophila_2:1637919_at:150:267; Interrogation_Position=62; Antisense; CAGGTGCTTACGTCCATCAGTGGGT
>probe:Drosophila_2:1637919_at:520:563; Interrogation_Position=96; Antisense; GGAAGATTACCACTCGGACCTAAAG

Paste this into a BLAST search page for me
ACATCGAGACGTTTTGCTGCCTGTAGTCATCTGGAGCATTAAATACCCTAAGTTGGCCCTTAATCCAGGTATCTTAAGGACTGCATTGAGCACTGCCAATGCACTGCCAATGCTCGAACAAGTCAAAGCCCCGGATGGTGGTGTCTCTTCGTCTCTTCTGGGAATGTTTGCCATGAATACCCTAGCTATTGTCTTGCTCTTTGCCATGCTAACCGAGTCGATCTAGAAAGTTTGGGCAGGATGCGCTCTTGAGTTGGTCGGCGACATGGCCACAATCTTGCTCTTGATGCCAGGTGCTTACAGGTGCTTACGTCCATCAGTGGGTGGAAGATTACCACTCGGACCTAAAG

Full Affymetrix probeset data:

Annotations for 1637919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720