FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637922_at:

>probe:Drosophila_2:1637922_at:660:151; Interrogation_Position=1063; Antisense; ACATGGATGACTGTGGCCCTAGCAT
>probe:Drosophila_2:1637922_at:655:445; Interrogation_Position=1090; Antisense; GATGCCCATGTTCGCGTAGTCGAAA
>probe:Drosophila_2:1637922_at:585:635; Interrogation_Position=1153; Antisense; TCGCTCGTTGAAATTCCTGCTGGAA
>probe:Drosophila_2:1637922_at:85:563; Interrogation_Position=1174; Antisense; GGAATCGTACCAATGCTTTTGCTAG
>probe:Drosophila_2:1637922_at:708:247; Interrogation_Position=1203; Antisense; AATTGGTCGCAAGCCCATGATGTCG
>probe:Drosophila_2:1637922_at:187:501; Interrogation_Position=1224; Antisense; GTCGGCTGTCATGCTATTGTGTGCA
>probe:Drosophila_2:1637922_at:28:267; Interrogation_Position=1254; Antisense; CAGTCTCTTCGTTGGTATTCTAAAA
>probe:Drosophila_2:1637922_at:395:5; Interrogation_Position=1306; Antisense; ATTGCAGCCAGATTTTTCGCCACAA
>probe:Drosophila_2:1637922_at:323:593; Interrogation_Position=1343; Antisense; TGGGTCAACAGTGGGCCTCTGAGAT
>probe:Drosophila_2:1637922_at:429:623; Interrogation_Position=1382; Antisense; TGCGCGGTCAGGGACTGGCTATTAT
>probe:Drosophila_2:1637922_at:31:681; Interrogation_Position=1413; Antisense; TATGGGTCAGATGGGTGCCCTACTC
>probe:Drosophila_2:1637922_at:609:633; Interrogation_Position=1473; Antisense; TCCCTTGCCCATGTTTATTATCACA
>probe:Drosophila_2:1637922_at:121:151; Interrogation_Position=1495; Antisense; ACATTGGTGTCCGTGATAGGCGCTT
>probe:Drosophila_2:1637922_at:32:415; Interrogation_Position=1542; Antisense; GACCAAGGGAGCTACGATGCCACAA

Paste this into a BLAST search page for me
ACATGGATGACTGTGGCCCTAGCATGATGCCCATGTTCGCGTAGTCGAAATCGCTCGTTGAAATTCCTGCTGGAAGGAATCGTACCAATGCTTTTGCTAGAATTGGTCGCAAGCCCATGATGTCGGTCGGCTGTCATGCTATTGTGTGCACAGTCTCTTCGTTGGTATTCTAAAAATTGCAGCCAGATTTTTCGCCACAATGGGTCAACAGTGGGCCTCTGAGATTGCGCGGTCAGGGACTGGCTATTATTATGGGTCAGATGGGTGCCCTACTCTCCCTTGCCCATGTTTATTATCACAACATTGGTGTCCGTGATAGGCGCTTGACCAAGGGAGCTACGATGCCACAA

Full Affymetrix probeset data:

Annotations for 1637922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720