Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637926_s_at:

>probe:Drosophila_2:1637926_s_at:161:11; Interrogation_Position=107; Antisense; ATTCTGGAAATCACAACACGAGGTC
>probe:Drosophila_2:1637926_s_at:394:157; Interrogation_Position=122; Antisense; ACACGAGGTCAAGGGTCAATGCACA
>probe:Drosophila_2:1637926_s_at:148:495; Interrogation_Position=136; Antisense; GTCAATGCACAGTCAACCACAAAGG
>probe:Drosophila_2:1637926_s_at:353:415; Interrogation_Position=163; Antisense; GAGCCAAGAAGCGTATATCCCAACA
>probe:Drosophila_2:1637926_s_at:134:483; Interrogation_Position=175; Antisense; GTATATCCCAACAGCTGTTCTGCCG
>probe:Drosophila_2:1637926_s_at:535:233; Interrogation_Position=205; Antisense; AATCCGGATGCCAAACTGGCACACT
>probe:Drosophila_2:1637926_s_at:699:613; Interrogation_Position=371; Antisense; TGAAGTCCCTCACCATCGATATAGG
>probe:Drosophila_2:1637926_s_at:399:71; Interrogation_Position=393; Antisense; AGGCAATGAGGTGCGCTACCAGGAC
>probe:Drosophila_2:1637926_s_at:63:75; Interrogation_Position=413; Antisense; AGGACAAGCTGCTGCGCGGCATCGA
>probe:Drosophila_2:1637926_s_at:639:39; Interrogation_Position=433; Antisense; ATCGACGACGACATGGACCGGACGA
>probe:Drosophila_2:1637926_s_at:304:127; Interrogation_Position=449; Antisense; ACCGGACGAGTGGATTTCTGGGCAA
>probe:Drosophila_2:1637926_s_at:34:313; Interrogation_Position=521; Antisense; GCCAAATGTGCTACATGTTCCTCTT
>probe:Drosophila_2:1637926_s_at:156:293; Interrogation_Position=552; Antisense; CGTCGTGTTCTTAATCCTCTGGATA
>probe:Drosophila_2:1637926_s_at:702:437; Interrogation_Position=90; Antisense; GAGGCATTAGTCAACCGATTCTGGA

Paste this into a BLAST search page for me
ATTCTGGAAATCACAACACGAGGTCACACGAGGTCAAGGGTCAATGCACAGTCAATGCACAGTCAACCACAAAGGGAGCCAAGAAGCGTATATCCCAACAGTATATCCCAACAGCTGTTCTGCCGAATCCGGATGCCAAACTGGCACACTTGAAGTCCCTCACCATCGATATAGGAGGCAATGAGGTGCGCTACCAGGACAGGACAAGCTGCTGCGCGGCATCGAATCGACGACGACATGGACCGGACGAACCGGACGAGTGGATTTCTGGGCAAGCCAAATGTGCTACATGTTCCTCTTCGTCGTGTTCTTAATCCTCTGGATAGAGGCATTAGTCAACCGATTCTGGA

Full Affymetrix probeset data:

Annotations for 1637926_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime