Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637928_at:

>probe:Drosophila_2:1637928_at:613:243; Interrogation_Position=1600; Antisense; AATATTACCTTCATATCTGCCTGCC
>probe:Drosophila_2:1637928_at:358:535; Interrogation_Position=1685; Antisense; GGTGCATGGGCAACGTTTCTAGCAT
>probe:Drosophila_2:1637928_at:149:293; Interrogation_Position=1698; Antisense; CGTTTCTAGCATAATCTCTCTGTCT
>probe:Drosophila_2:1637928_at:367:657; Interrogation_Position=1722; Antisense; TAATGTGACGTCTTTGGCATCCCAG
>probe:Drosophila_2:1637928_at:401:415; Interrogation_Position=1766; Antisense; GAGCCTGTCCGGTGGACTGCAACAA
>probe:Drosophila_2:1637928_at:262:179; Interrogation_Position=1789; Antisense; AAACAGTTCCTTATCTTCTTGGCCG
>probe:Drosophila_2:1637928_at:268:57; Interrogation_Position=1816; Antisense; ATGTGCTTCCTTAAGTTCGTGGGCG
>probe:Drosophila_2:1637928_at:54:577; Interrogation_Position=1837; Antisense; GGCGCCACTGGGAGATCGAGTAATC
>probe:Drosophila_2:1637928_at:170:431; Interrogation_Position=1854; Antisense; GAGTAATCTGTTATTAGCCCTGAGA
>probe:Drosophila_2:1637928_at:217:427; Interrogation_Position=1875; Antisense; GAGATGCGTTCCCTCGAAGGACAAA
>probe:Drosophila_2:1637928_at:221:715; Interrogation_Position=1903; Antisense; TTCTCCTTAGGTTTCGGCAGTATGG
>probe:Drosophila_2:1637928_at:491:299; Interrogation_Position=1951; Antisense; CCCAGTCCCATTGTGTTTGGTTGGA
>probe:Drosophila_2:1637928_at:622:391; Interrogation_Position=2003; Antisense; GAAAGACCTGCAGCTCCAAGGGTAA
>probe:Drosophila_2:1637928_at:61:447; Interrogation_Position=2041; Antisense; GATACGAAGTCTCTCAGCTTTTGGA

Paste this into a BLAST search page for me
AATATTACCTTCATATCTGCCTGCCGGTGCATGGGCAACGTTTCTAGCATCGTTTCTAGCATAATCTCTCTGTCTTAATGTGACGTCTTTGGCATCCCAGGAGCCTGTCCGGTGGACTGCAACAAAAACAGTTCCTTATCTTCTTGGCCGATGTGCTTCCTTAAGTTCGTGGGCGGGCGCCACTGGGAGATCGAGTAATCGAGTAATCTGTTATTAGCCCTGAGAGAGATGCGTTCCCTCGAAGGACAAATTCTCCTTAGGTTTCGGCAGTATGGCCCAGTCCCATTGTGTTTGGTTGGAGAAAGACCTGCAGCTCCAAGGGTAAGATACGAAGTCTCTCAGCTTTTGGA

Full Affymetrix probeset data:

Annotations for 1637928_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime