FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637930_at:

>probe:Drosophila_2:1637930_at:359:573; Interrogation_Position=119; Antisense; GGCTGATCACCCTCCAAACTGGAAG
>probe:Drosophila_2:1637930_at:483:125; Interrogation_Position=153; Antisense; AGCCCCGCCACAGGAAGTGATCATA
>probe:Drosophila_2:1637930_at:473:453; Interrogation_Position=190; Antisense; GATCATCAACATTATCATCCGCCAC
>probe:Drosophila_2:1637930_at:182:157; Interrogation_Position=213; Antisense; ACACTATCCGCCAAGCTATTCGTAT
>probe:Drosophila_2:1637930_at:416:207; Interrogation_Position=225; Antisense; AAGCTATTCGTATCCGTATCCTCAG
>probe:Drosophila_2:1637930_at:246:421; Interrogation_Position=374; Antisense; GAGATAAGGGCCACCCCGGGATGCC
>probe:Drosophila_2:1637930_at:683:591; Interrogation_Position=417; Antisense; TGGTCCTCAGGGTCCTCCTGGATAT
>probe:Drosophila_2:1637930_at:652:77; Interrogation_Position=447; Antisense; AGGTTCATATCCACCGTATCCGTAT
>probe:Drosophila_2:1637930_at:316:313; Interrogation_Position=518; Antisense; GCCACCAGAGGCACTACTATAACTA
>probe:Drosophila_2:1637930_at:721:565; Interrogation_Position=568; Antisense; GGCAATGAGCGTTCTTTTGGTCTGA
>probe:Drosophila_2:1637930_at:190:211; Interrogation_Position=602; Antisense; AAGAATTCGACGACCAGCCCTTCAT
>probe:Drosophila_2:1637930_at:78:125; Interrogation_Position=617; Antisense; AGCCCTTCATTTTGGCCTTTAGTGA
>probe:Drosophila_2:1637930_at:709:135; Interrogation_Position=642; Antisense; ACGCAGAAATCCGTTTAGCACAAAA
>probe:Drosophila_2:1637930_at:254:477; Interrogation_Position=88; Antisense; GTTTTCGCCAAGGATGATGCCTCAG

Paste this into a BLAST search page for me
GGCTGATCACCCTCCAAACTGGAAGAGCCCCGCCACAGGAAGTGATCATAGATCATCAACATTATCATCCGCCACACACTATCCGCCAAGCTATTCGTATAAGCTATTCGTATCCGTATCCTCAGGAGATAAGGGCCACCCCGGGATGCCTGGTCCTCAGGGTCCTCCTGGATATAGGTTCATATCCACCGTATCCGTATGCCACCAGAGGCACTACTATAACTAGGCAATGAGCGTTCTTTTGGTCTGAAAGAATTCGACGACCAGCCCTTCATAGCCCTTCATTTTGGCCTTTAGTGAACGCAGAAATCCGTTTAGCACAAAAGTTTTCGCCAAGGATGATGCCTCAG

Full Affymetrix probeset data:

Annotations for 1637930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720