FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637931_at:

>probe:Drosophila_2:1637931_at:693:289; Interrogation_Position=101; Antisense; CGGATCATGCCGGATGTATACGGAT
>probe:Drosophila_2:1637931_at:663:625; Interrogation_Position=108; Antisense; TGCCGGATGTATACGGATAACGATC
>probe:Drosophila_2:1637931_at:3:545; Interrogation_Position=122; Antisense; GGATAACGATCATCAAGCGACCATT
>probe:Drosophila_2:1637931_at:266:199; Interrogation_Position=126; Antisense; AACGATCATCAAGCGACCATTGGCC
>probe:Drosophila_2:1637931_at:84:59; Interrogation_Position=13; Antisense; ATGAGGCAATCCATAAAGCACATAT
>probe:Drosophila_2:1637931_at:60:103; Interrogation_Position=205; Antisense; AGAGCAACAACCACGGCCGCTGGTT
>probe:Drosophila_2:1637931_at:183:173; Interrogation_Position=27; Antisense; AAAGCACATATTCGCACTGTTGGTT
>probe:Drosophila_2:1637931_at:304:21; Interrogation_Position=34; Antisense; ATATTCGCACTGTTGGTTGCCCTGG
>probe:Drosophila_2:1637931_at:16:557; Interrogation_Position=47; Antisense; TGGTTGCCCTGGAGTGTTTAAGCCT
>probe:Drosophila_2:1637931_at:656:301; Interrogation_Position=53; Antisense; CCCTGGAGTGTTTAAGCCTTGGCGA
>probe:Drosophila_2:1637931_at:190:515; Interrogation_Position=60; Antisense; GTGTTTAAGCCTTGGCGACACGGCG
>probe:Drosophila_2:1637931_at:522:659; Interrogation_Position=65; Antisense; TAAGCCTTGGCGACACGGCGCCCAT
>probe:Drosophila_2:1637931_at:484:575; Interrogation_Position=81; Antisense; GGCGCCCATCGGTGAGCATCCGGAT
>probe:Drosophila_2:1637931_at:336:39; Interrogation_Position=88; Antisense; ATCGGTGAGCATCCGGATCATGCCG

Paste this into a BLAST search page for me
CGGATCATGCCGGATGTATACGGATTGCCGGATGTATACGGATAACGATCGGATAACGATCATCAAGCGACCATTAACGATCATCAAGCGACCATTGGCCATGAGGCAATCCATAAAGCACATATAGAGCAACAACCACGGCCGCTGGTTAAAGCACATATTCGCACTGTTGGTTATATTCGCACTGTTGGTTGCCCTGGTGGTTGCCCTGGAGTGTTTAAGCCTCCCTGGAGTGTTTAAGCCTTGGCGAGTGTTTAAGCCTTGGCGACACGGCGTAAGCCTTGGCGACACGGCGCCCATGGCGCCCATCGGTGAGCATCCGGATATCGGTGAGCATCCGGATCATGCCG

Full Affymetrix probeset data:

Annotations for 1637931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720