FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637932_at:

>probe:Drosophila_2:1637932_at:681:355; Interrogation_Position=113; Antisense; GCAACGCCGGTAACGTCGGTGGCTC
>probe:Drosophila_2:1637932_at:380:501; Interrogation_Position=127; Antisense; GTCGGTGGCTCAACCCTAAATAATG
>probe:Drosophila_2:1637932_at:430:67; Interrogation_Position=13; Antisense; ATGGCATACCACCTCGAAGCGATTT
>probe:Drosophila_2:1637932_at:268:521; Interrogation_Position=174; Antisense; GTGGCTTGCGGATGCGGATTCGAAT
>probe:Drosophila_2:1637932_at:160:369; Interrogation_Position=219; Antisense; GAATGCGGGCTCGTATTCCGTGCAC
>probe:Drosophila_2:1637932_at:688:481; Interrogation_Position=231; Antisense; GTATTCCGTGCACTCTGTGCTACTT
>probe:Drosophila_2:1637932_at:317:145; Interrogation_Position=242; Antisense; ACTCTGTGCTACTTTTGTGGGTTTT
>probe:Drosophila_2:1637932_at:232:687; Interrogation_Position=255; Antisense; TTTGTGGGTTTTGTGCGCCATGTAA
>probe:Drosophila_2:1637932_at:368:377; Interrogation_Position=28; Antisense; GAAGCGATTTCTTCGTTTCTGTATG
>probe:Drosophila_2:1637932_at:546:17; Interrogation_Position=34; Antisense; ATTTCTTCGTTTCTGTATGTGGGCC
>probe:Drosophila_2:1637932_at:311:63; Interrogation_Position=50; Antisense; ATGTGGGCCTTGGTTGCCTGATTGC
>probe:Drosophila_2:1637932_at:618:603; Interrogation_Position=68; Antisense; TGATTGCCTCCTCTGTGGCACTAAG
>probe:Drosophila_2:1637932_at:429:521; Interrogation_Position=82; Antisense; GTGGCACTAAGTACAGATACTGGAA
>probe:Drosophila_2:1637932_at:394:27; Interrogation_Position=98; Antisense; ATACTGGAAGTGAAGGCAACGCCGG

Paste this into a BLAST search page for me
GCAACGCCGGTAACGTCGGTGGCTCGTCGGTGGCTCAACCCTAAATAATGATGGCATACCACCTCGAAGCGATTTGTGGCTTGCGGATGCGGATTCGAATGAATGCGGGCTCGTATTCCGTGCACGTATTCCGTGCACTCTGTGCTACTTACTCTGTGCTACTTTTGTGGGTTTTTTTGTGGGTTTTGTGCGCCATGTAAGAAGCGATTTCTTCGTTTCTGTATGATTTCTTCGTTTCTGTATGTGGGCCATGTGGGCCTTGGTTGCCTGATTGCTGATTGCCTCCTCTGTGGCACTAAGGTGGCACTAAGTACAGATACTGGAAATACTGGAAGTGAAGGCAACGCCGG

Full Affymetrix probeset data:

Annotations for 1637932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720