Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637935_at:

>probe:Drosophila_2:1637935_at:80:699; Interrogation_Position=1067; Antisense; TTTTCGTTCGCATTCAAACTATTTG
>probe:Drosophila_2:1637935_at:599:529; Interrogation_Position=1114; Antisense; GGGATCCCACTCAATTGTTTAATTC
>probe:Drosophila_2:1637935_at:523:515; Interrogation_Position=635; Antisense; GTGTAGTTCATCTAAGCCAGTAGTT
>probe:Drosophila_2:1637935_at:400:33; Interrogation_Position=661; Antisense; ATCAAGTTGAGATCTGGCCAGGCTT
>probe:Drosophila_2:1637935_at:71:41; Interrogation_Position=672; Antisense; ATCTGGCCAGGCTTTTTACAAAAGG
>probe:Drosophila_2:1637935_at:370:557; Interrogation_Position=695; Antisense; GGACTTGGTTGATTATTGCCGCTAC
>probe:Drosophila_2:1637935_at:184:461; Interrogation_Position=705; Antisense; GATTATTGCCGCTACAACGGGAATT
>probe:Drosophila_2:1637935_at:378:691; Interrogation_Position=729; Antisense; TATTGTGACAGCCTTTTCACCTCTT
>probe:Drosophila_2:1637935_at:720:697; Interrogation_Position=743; Antisense; TTTCACCTCTTGGTCAACCAAACAG
>probe:Drosophila_2:1637935_at:260:7; Interrogation_Position=776; Antisense; ATTGCCCAGTGTATTTCTTTTCGGA
>probe:Drosophila_2:1637935_at:179:491; Interrogation_Position=826; Antisense; GTACAAGCGCTCTGCAAGTCAAATT
>probe:Drosophila_2:1637935_at:552:133; Interrogation_Position=908; Antisense; ACGGATTTTGGAGATCGACTACGGA
>probe:Drosophila_2:1637935_at:73:403; Interrogation_Position=924; Antisense; GACTACGGAGTAGTTCCAATACCAA
>probe:Drosophila_2:1637935_at:310:183; Interrogation_Position=947; Antisense; AAAAGCTGCGAACCCAATACATATA

Paste this into a BLAST search page for me
TTTTCGTTCGCATTCAAACTATTTGGGGATCCCACTCAATTGTTTAATTCGTGTAGTTCATCTAAGCCAGTAGTTATCAAGTTGAGATCTGGCCAGGCTTATCTGGCCAGGCTTTTTACAAAAGGGGACTTGGTTGATTATTGCCGCTACGATTATTGCCGCTACAACGGGAATTTATTGTGACAGCCTTTTCACCTCTTTTTCACCTCTTGGTCAACCAAACAGATTGCCCAGTGTATTTCTTTTCGGAGTACAAGCGCTCTGCAAGTCAAATTACGGATTTTGGAGATCGACTACGGAGACTACGGAGTAGTTCCAATACCAAAAAAGCTGCGAACCCAATACATATA

Full Affymetrix probeset data:

Annotations for 1637935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime