Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637936_at:

>probe:Drosophila_2:1637936_at:439:671; Interrogation_Position=1657; Antisense; TAGGTATCCACCACATAACAACGCA
>probe:Drosophila_2:1637936_at:695:705; Interrogation_Position=1698; Antisense; TTACTACTACTGTACGTTCCACGTT
>probe:Drosophila_2:1637936_at:94:471; Interrogation_Position=1713; Antisense; GTTCCACGTTCGATAAATGTCTCAA
>probe:Drosophila_2:1637936_at:261:25; Interrogation_Position=1744; Antisense; ATATGGCTTATTGAACACTTGAGTT
>probe:Drosophila_2:1637936_at:88:609; Interrogation_Position=1763; Antisense; TGAGTTTTTGAACTGGTCCTCCATC
>probe:Drosophila_2:1637936_at:114:309; Interrogation_Position=1832; Antisense; CCATACGCCCATGCACGAAAATATT
>probe:Drosophila_2:1637936_at:409:695; Interrogation_Position=1855; Antisense; TTTAATTTCTCCCAAGGACGCCTTG
>probe:Drosophila_2:1637936_at:658:223; Interrogation_Position=1868; Antisense; AAGGACGCCTTGTTTGCGACGACCT
>probe:Drosophila_2:1637936_at:367:623; Interrogation_Position=1882; Antisense; TGCGACGACCTTTCCAATCTGATTT
>probe:Drosophila_2:1637936_at:621:459; Interrogation_Position=1902; Antisense; GATTTCCTGTGATAAACTCAGCCCA
>probe:Drosophila_2:1637936_at:44:357; Interrogation_Position=1953; Antisense; GCAAACCACAGCACATTTAGCCTAG
>probe:Drosophila_2:1637936_at:638:697; Interrogation_Position=1968; Antisense; TTTAGCCTAGAGTTGATAGCCAATA
>probe:Drosophila_2:1637936_at:239:499; Interrogation_Position=2055; Antisense; GTCTCATTCATTAATTTTCTTCTGT
>probe:Drosophila_2:1637936_at:390:477; Interrogation_Position=2105; Antisense; GTTTTTCTCTGTTTTAAGTGCGGAT

Paste this into a BLAST search page for me
TAGGTATCCACCACATAACAACGCATTACTACTACTGTACGTTCCACGTTGTTCCACGTTCGATAAATGTCTCAAATATGGCTTATTGAACACTTGAGTTTGAGTTTTTGAACTGGTCCTCCATCCCATACGCCCATGCACGAAAATATTTTTAATTTCTCCCAAGGACGCCTTGAAGGACGCCTTGTTTGCGACGACCTTGCGACGACCTTTCCAATCTGATTTGATTTCCTGTGATAAACTCAGCCCAGCAAACCACAGCACATTTAGCCTAGTTTAGCCTAGAGTTGATAGCCAATAGTCTCATTCATTAATTTTCTTCTGTGTTTTTCTCTGTTTTAAGTGCGGAT

Full Affymetrix probeset data:

Annotations for 1637936_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime