FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637938_at:

>probe:Drosophila_2:1637938_at:56:149; Interrogation_Position=1019; Antisense; ACTATAGTCCCGAGTGGTATCCTGG
>probe:Drosophila_2:1637938_at:552:189; Interrogation_Position=481; Antisense; AACATCAGGCCCATTTGCGTTGTGT
>probe:Drosophila_2:1637938_at:412:165; Interrogation_Position=536; Antisense; AAATCGATTTGCTCACTGCTACTGG
>probe:Drosophila_2:1637938_at:164:513; Interrogation_Position=590; Antisense; GTGATGCTCTTCAGACACTGGACAT
>probe:Drosophila_2:1637938_at:712:311; Interrogation_Position=620; Antisense; GCCAACCACCAGATGTGTGCGCTAA
>probe:Drosophila_2:1637938_at:469:597; Interrogation_Position=635; Antisense; TGTGCGCTAAGTTCATCGGCCAGAC
>probe:Drosophila_2:1637938_at:193:333; Interrogation_Position=664; Antisense; GCTGGTAACCAATTCTGCGCAGGAA
>probe:Drosophila_2:1637938_at:64:529; Interrogation_Position=692; Antisense; GGGATAGTAATCTCTGCAATGGCGA
>probe:Drosophila_2:1637938_at:445:293; Interrogation_Position=714; Antisense; CGATTCCGGTGGTCCATTGGGAGCA
>probe:Drosophila_2:1637938_at:637:155; Interrogation_Position=759; Antisense; ACAGCGCTTTGTGCAAGTCGGTATA
>probe:Drosophila_2:1637938_at:659:513; Interrogation_Position=818; Antisense; GTGTTTTCACTGACGTTCTGAGCCA
>probe:Drosophila_2:1637938_at:643:415; Interrogation_Position=837; Antisense; GAGCCATGCCGAATTTATCCTTCGA
>probe:Drosophila_2:1637938_at:672:649; Interrogation_Position=885; Antisense; TCAAACGCTACCGATCCCAAAGAAA
>probe:Drosophila_2:1637938_at:280:153; Interrogation_Position=934; Antisense; ACATGGTGGCATACTACTCGGATTC

Paste this into a BLAST search page for me
ACTATAGTCCCGAGTGGTATCCTGGAACATCAGGCCCATTTGCGTTGTGTAAATCGATTTGCTCACTGCTACTGGGTGATGCTCTTCAGACACTGGACATGCCAACCACCAGATGTGTGCGCTAATGTGCGCTAAGTTCATCGGCCAGACGCTGGTAACCAATTCTGCGCAGGAAGGGATAGTAATCTCTGCAATGGCGACGATTCCGGTGGTCCATTGGGAGCAACAGCGCTTTGTGCAAGTCGGTATAGTGTTTTCACTGACGTTCTGAGCCAGAGCCATGCCGAATTTATCCTTCGATCAAACGCTACCGATCCCAAAGAAAACATGGTGGCATACTACTCGGATTC

Full Affymetrix probeset data:

Annotations for 1637938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720