Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637941_at:

>probe:Drosophila_2:1637941_at:647:463; Interrogation_Position=123; Antisense; GATTCCCAATCTGCAAGTCATCAAG
>probe:Drosophila_2:1637941_at:535:249; Interrogation_Position=144; Antisense; CAAGGTGATGCAGTCGCTGAACTCA
>probe:Drosophila_2:1637941_at:550:329; Interrogation_Position=159; Antisense; GCTGAACTCACGTGGCTGGGTCAAG
>probe:Drosophila_2:1637941_at:556:7; Interrogation_Position=19; Antisense; ATTCCAAAAGCCAATCGTGTCGCCA
>probe:Drosophila_2:1637941_at:125:583; Interrogation_Position=196; Antisense; TGGCGCCACTTCTACTGGTTGCTGA
>probe:Drosophila_2:1637941_at:375:287; Interrogation_Position=210; Antisense; CTGGTTGCTGACCAACGAGGGCATC
>probe:Drosophila_2:1637941_at:212:83; Interrogation_Position=227; Antisense; AGGGCATCGAGGAACTGCGCCGCTA
>probe:Drosophila_2:1637941_at:663:3; Interrogation_Position=271; Antisense; ATTGTGCCCTCCACTTTGACGCAAA
>probe:Drosophila_2:1637941_at:658:191; Interrogation_Position=294; Antisense; AACTACTCGATCGAACGCAGTGCGT
>probe:Drosophila_2:1637941_at:544:439; Interrogation_Position=356; Antisense; GAGGCGCCTCCAAAACCGATGACGA
>probe:Drosophila_2:1637941_at:352:97; Interrogation_Position=382; Antisense; AGATCGAACTACAGACGCGGTCCAG
>probe:Drosophila_2:1637941_at:157:105; Interrogation_Position=394; Antisense; AGACGCGGTCCAGGCGCATATGGAA
>probe:Drosophila_2:1637941_at:157:623; Interrogation_Position=441; Antisense; TGCCGGAACCGGACGGGTCGAATAT
>probe:Drosophila_2:1637941_at:535:639; Interrogation_Position=480; Antisense; TCGTGCTTCTCGCTACGACAATTAA

Paste this into a BLAST search page for me
GATTCCCAATCTGCAAGTCATCAAGCAAGGTGATGCAGTCGCTGAACTCAGCTGAACTCACGTGGCTGGGTCAAGATTCCAAAAGCCAATCGTGTCGCCATGGCGCCACTTCTACTGGTTGCTGACTGGTTGCTGACCAACGAGGGCATCAGGGCATCGAGGAACTGCGCCGCTAATTGTGCCCTCCACTTTGACGCAAAAACTACTCGATCGAACGCAGTGCGTGAGGCGCCTCCAAAACCGATGACGAAGATCGAACTACAGACGCGGTCCAGAGACGCGGTCCAGGCGCATATGGAATGCCGGAACCGGACGGGTCGAATATTCGTGCTTCTCGCTACGACAATTAA

Full Affymetrix probeset data:

Annotations for 1637941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime