FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637942_at:

>probe:Drosophila_2:1637942_at:563:463; Interrogation_Position=3295; Antisense; GATTGGGTGTGGGTGCCACCTACCA
>probe:Drosophila_2:1637942_at:123:569; Interrogation_Position=3334; Antisense; GGCAGCAGTTCCAAATCGGCAACGC
>probe:Drosophila_2:1637942_at:216:625; Interrogation_Position=3415; Antisense; TGCCCACAAATGCTGGTGCGTTCAT
>probe:Drosophila_2:1637942_at:227:619; Interrogation_Position=3431; Antisense; TGCGTTCATGGGTGCGCTACCGAAA
>probe:Drosophila_2:1637942_at:531:311; Interrogation_Position=3570; Antisense; GCCACCATCCTCACATAGGCGAAAG
>probe:Drosophila_2:1637942_at:416:295; Interrogation_Position=3589; Antisense; CGAAAGGATCGATCGCGCACCCGGG
>probe:Drosophila_2:1637942_at:143:79; Interrogation_Position=3607; Antisense; ACCCGGGTAGCCAGTCAGTATTATG
>probe:Drosophila_2:1637942_at:415:367; Interrogation_Position=3631; Antisense; GAATCCGTCTGATATTCACCATAAT
>probe:Drosophila_2:1637942_at:17:655; Interrogation_Position=3652; Antisense; TAATCCGAACCGTCACACATTGTAG
>probe:Drosophila_2:1637942_at:8:487; Interrogation_Position=3673; Antisense; GTAGTTTTGAGGCAAGCTGTGTTCC
>probe:Drosophila_2:1637942_at:395:207; Interrogation_Position=3686; Antisense; AAGCTGTGTTCCATGTTGTTGTCGT
>probe:Drosophila_2:1637942_at:287:461; Interrogation_Position=3703; Antisense; GTTGTCGTTGTTGTTAACCTTGTCG
>probe:Drosophila_2:1637942_at:609:201; Interrogation_Position=3718; Antisense; AACCTTGTCGTTGGCATAATTGTTG
>probe:Drosophila_2:1637942_at:94:53; Interrogation_Position=3755; Antisense; ATGCATGTTGTAGTCTTAGGCGTAA

Paste this into a BLAST search page for me
GATTGGGTGTGGGTGCCACCTACCAGGCAGCAGTTCCAAATCGGCAACGCTGCCCACAAATGCTGGTGCGTTCATTGCGTTCATGGGTGCGCTACCGAAAGCCACCATCCTCACATAGGCGAAAGCGAAAGGATCGATCGCGCACCCGGGACCCGGGTAGCCAGTCAGTATTATGGAATCCGTCTGATATTCACCATAATTAATCCGAACCGTCACACATTGTAGGTAGTTTTGAGGCAAGCTGTGTTCCAAGCTGTGTTCCATGTTGTTGTCGTGTTGTCGTTGTTGTTAACCTTGTCGAACCTTGTCGTTGGCATAATTGTTGATGCATGTTGTAGTCTTAGGCGTAA

Full Affymetrix probeset data:

Annotations for 1637942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720