FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637944_at:

>probe:Drosophila_2:1637944_at:153:191; Interrogation_Position=1834; Antisense; AACATCTTGTGCAACATCTTCCGTT
>probe:Drosophila_2:1637944_at:598:717; Interrogation_Position=1880; Antisense; TTCGCTATCGCGATTTCTGCAAGGC
>probe:Drosophila_2:1637944_at:567:427; Interrogation_Position=1912; Antisense; GAGATCTTCATCCAACTGGACACGA
>probe:Drosophila_2:1637944_at:594:19; Interrogation_Position=1976; Antisense; ATTTGCCCAATCTGGACTGCGTCGA
>probe:Drosophila_2:1637944_at:423:619; Interrogation_Position=2002; Antisense; TGCTTCCTGAGCTTCGACGAGCGAA
>probe:Drosophila_2:1637944_at:153:427; Interrogation_Position=2071; Antisense; GAGATCTCCAATCTGAGTCAGCTGT
>probe:Drosophila_2:1637944_at:33:189; Interrogation_Position=2114; Antisense; AACAGTGCGGCTCGATCACGCAGAA
>probe:Drosophila_2:1637944_at:304:35; Interrogation_Position=2155; Antisense; ATCACGGTGCGCGACATGCATGTAA
>probe:Drosophila_2:1637944_at:276:609; Interrogation_Position=2183; Antisense; TGAGCAGCCGCGAGTTCCAAGCGAT
>probe:Drosophila_2:1637944_at:67:295; Interrogation_Position=2204; Antisense; CGATCTGCAAGTGCTTCGGCGTGAA
>probe:Drosophila_2:1637944_at:286:539; Interrogation_Position=2244; Antisense; GGAGTTCAACTACCGGGAGTTCCTG
>probe:Drosophila_2:1637944_at:148:93; Interrogation_Position=2261; Antisense; AGTTCCTGAAAATCCTCGACGTGCT
>probe:Drosophila_2:1637944_at:212:653; Interrogation_Position=2317; Antisense; TAGTGGCGCGAAAACTAACCCTCTC
>probe:Drosophila_2:1637944_at:289:201; Interrogation_Position=2333; Antisense; AACCCTCTCCAAATTCCAAGTGTAT

Paste this into a BLAST search page for me
AACATCTTGTGCAACATCTTCCGTTTTCGCTATCGCGATTTCTGCAAGGCGAGATCTTCATCCAACTGGACACGAATTTGCCCAATCTGGACTGCGTCGATGCTTCCTGAGCTTCGACGAGCGAAGAGATCTCCAATCTGAGTCAGCTGTAACAGTGCGGCTCGATCACGCAGAAATCACGGTGCGCGACATGCATGTAATGAGCAGCCGCGAGTTCCAAGCGATCGATCTGCAAGTGCTTCGGCGTGAAGGAGTTCAACTACCGGGAGTTCCTGAGTTCCTGAAAATCCTCGACGTGCTTAGTGGCGCGAAAACTAACCCTCTCAACCCTCTCCAAATTCCAAGTGTAT

Full Affymetrix probeset data:

Annotations for 1637944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720