Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637946_at:

>probe:Drosophila_2:1637946_at:597:439; Interrogation_Position=1023; Antisense; GATGGCTCCTCAGAAAGTGCCGCAG
>probe:Drosophila_2:1637946_at:413:353; Interrogation_Position=1044; Antisense; GCAGCTGGCGCGGATTTCAAGAAGC
>probe:Drosophila_2:1637946_at:726:709; Interrogation_Position=1059; Antisense; TTCAAGAAGCCCAACACGACCAAAT
>probe:Drosophila_2:1637946_at:292:577; Interrogation_Position=1114; Antisense; GGCGCATTGATCTGTCCAAGTCGGA
>probe:Drosophila_2:1637946_at:412:453; Interrogation_Position=1173; Antisense; GATAAGTTCCTTAACTTGCGCCTGC
>probe:Drosophila_2:1637946_at:169:141; Interrogation_Position=1245; Antisense; ACTGTTGGCCAGATGCAGGGTCGCT
>probe:Drosophila_2:1637946_at:636:81; Interrogation_Position=1261; Antisense; AGGGTCGCTTCCAGATGCAGGTCTT
>probe:Drosophila_2:1637946_at:44:73; Interrogation_Position=1312; Antisense; AGGACCGTCCACACGAGGTGGCTGA
>probe:Drosophila_2:1637946_at:353:459; Interrogation_Position=1340; Antisense; GATTAGCGGCTACTTGATCCGGAAT
>probe:Drosophila_2:1637946_at:211:47; Interrogation_Position=1356; Antisense; ATCCGGAATCGGTTTGCAGAAGCAG
>probe:Drosophila_2:1637946_at:26:351; Interrogation_Position=1371; Antisense; GCAGAAGCAGCCAGCGAATTTCGTT
>probe:Drosophila_2:1637946_at:209:365; Interrogation_Position=1386; Antisense; GAATTTCGTTGCCACATGCCGTCGT
>probe:Drosophila_2:1637946_at:460:533; Interrogation_Position=1483; Antisense; GGTGCATTACTCTTTGAACTTACAG
>probe:Drosophila_2:1637946_at:472:679; Interrogation_Position=1547; Antisense; TAGGTCCAGATATATACAGCCGTAT

Paste this into a BLAST search page for me
GATGGCTCCTCAGAAAGTGCCGCAGGCAGCTGGCGCGGATTTCAAGAAGCTTCAAGAAGCCCAACACGACCAAATGGCGCATTGATCTGTCCAAGTCGGAGATAAGTTCCTTAACTTGCGCCTGCACTGTTGGCCAGATGCAGGGTCGCTAGGGTCGCTTCCAGATGCAGGTCTTAGGACCGTCCACACGAGGTGGCTGAGATTAGCGGCTACTTGATCCGGAATATCCGGAATCGGTTTGCAGAAGCAGGCAGAAGCAGCCAGCGAATTTCGTTGAATTTCGTTGCCACATGCCGTCGTGGTGCATTACTCTTTGAACTTACAGTAGGTCCAGATATATACAGCCGTAT

Full Affymetrix probeset data:

Annotations for 1637946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime