Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637950_at:

>probe:Drosophila_2:1637950_at:545:167; Interrogation_Position=109; Antisense; AAATGCTACCCTGCAAGTTGCTGAA
>probe:Drosophila_2:1637950_at:532:283; Interrogation_Position=119; Antisense; CTGCAAGTTGCTGAAGTCGCTTCGA
>probe:Drosophila_2:1637950_at:584:219; Interrogation_Position=132; Antisense; AAGTCGCTTCGAAAGCAGCCAATGT
>probe:Drosophila_2:1637950_at:468:517; Interrogation_Position=19; Antisense; GTGGATTTTATTTGTCCTCATCCTG
>probe:Drosophila_2:1637950_at:319:17; Interrogation_Position=23; Antisense; ATTTTATTTGTCCTCATCCTGACCA
>probe:Drosophila_2:1637950_at:94:47; Interrogation_Position=38; Antisense; ATCCTGACCACTTATTGGCCACAAT
>probe:Drosophila_2:1637950_at:121:611; Interrogation_Position=42; Antisense; TGACCACTTATTGGCCACAATTGGA
>probe:Drosophila_2:1637950_at:584:3; Interrogation_Position=51; Antisense; ATTGGCCACAATTGGAAGCTGGCTT
>probe:Drosophila_2:1637950_at:33:377; Interrogation_Position=65; Antisense; GAAGCTGGCTTCGACGGGACATTAG
>probe:Drosophila_2:1637950_at:3:579; Interrogation_Position=70; Antisense; TGGCTTCGACGGGACATTAGACGTT
>probe:Drosophila_2:1637950_at:685:267; Interrogation_Position=76; Antisense; CGACGGGACATTAGACGTTGGTCTA
>probe:Drosophila_2:1637950_at:663:673; Interrogation_Position=87; Antisense; TAGACGTTGGTCTATACACCCTAAA
>probe:Drosophila_2:1637950_at:297:337; Interrogation_Position=92; Antisense; GTTGGTCTATACACCCTAAATGCTA
>probe:Drosophila_2:1637950_at:6:687; Interrogation_Position=99; Antisense; TATACACCCTAAATGCTACCCTGCA

Paste this into a BLAST search page for me
AAATGCTACCCTGCAAGTTGCTGAACTGCAAGTTGCTGAAGTCGCTTCGAAAGTCGCTTCGAAAGCAGCCAATGTGTGGATTTTATTTGTCCTCATCCTGATTTTATTTGTCCTCATCCTGACCAATCCTGACCACTTATTGGCCACAATTGACCACTTATTGGCCACAATTGGAATTGGCCACAATTGGAAGCTGGCTTGAAGCTGGCTTCGACGGGACATTAGTGGCTTCGACGGGACATTAGACGTTCGACGGGACATTAGACGTTGGTCTATAGACGTTGGTCTATACACCCTAAAGTTGGTCTATACACCCTAAATGCTATATACACCCTAAATGCTACCCTGCA

Full Affymetrix probeset data:

Annotations for 1637950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime