FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637951_at:

>probe:Drosophila_2:1637951_at:407:131; Interrogation_Position=298; Antisense; ACCGACCTCGTGAAATGACCACCAG
>probe:Drosophila_2:1637951_at:635:609; Interrogation_Position=313; Antisense; TGACCACCAGACGACAGGTTCCATT
>probe:Drosophila_2:1637951_at:484:77; Interrogation_Position=328; Antisense; AGGTTCCATTTTTGGGCGCCGAGCA
>probe:Drosophila_2:1637951_at:180:305; Interrogation_Position=409; Antisense; CCGGAACATATAGTGCAGAAACCTT
>probe:Drosophila_2:1637951_at:300:375; Interrogation_Position=437; Antisense; GAAGAACTACCAGTTTGTCTCCCAG
>probe:Drosophila_2:1637951_at:210:479; Interrogation_Position=449; Antisense; GTTTGTCTCCCAGATTCGAGCAAAG
>probe:Drosophila_2:1637951_at:29:443; Interrogation_Position=513; Antisense; GATGAGGCGGAGAAGCACCATATAA
>probe:Drosophila_2:1637951_at:310:521; Interrogation_Position=584; Antisense; GTGGCACACCAAACAGAAGCAACTG
>probe:Drosophila_2:1637951_at:31:555; Interrogation_Position=614; Antisense; GGAGCGCTCCGCCATTCAGAAGAAA
>probe:Drosophila_2:1637951_at:708:593; Interrogation_Position=646; Antisense; TGGGACAACAACCTCATTATCTGAC
>probe:Drosophila_2:1637951_at:5:503; Interrogation_Position=682; Antisense; GTCGAGCTAAGGAACTAGTTGCCCA
>probe:Drosophila_2:1637951_at:685:675; Interrogation_Position=697; Antisense; TAGTTGCCCAATTCGAGAAGCTGAA
>probe:Drosophila_2:1637951_at:630:323; Interrogation_Position=755; Antisense; GCGACGCAAGAAGAACGCCGCCAAG
>probe:Drosophila_2:1637951_at:544:251; Interrogation_Position=776; Antisense; CAAGGACCGCAAACGCATTGGTATA

Paste this into a BLAST search page for me
ACCGACCTCGTGAAATGACCACCAGTGACCACCAGACGACAGGTTCCATTAGGTTCCATTTTTGGGCGCCGAGCACCGGAACATATAGTGCAGAAACCTTGAAGAACTACCAGTTTGTCTCCCAGGTTTGTCTCCCAGATTCGAGCAAAGGATGAGGCGGAGAAGCACCATATAAGTGGCACACCAAACAGAAGCAACTGGGAGCGCTCCGCCATTCAGAAGAAATGGGACAACAACCTCATTATCTGACGTCGAGCTAAGGAACTAGTTGCCCATAGTTGCCCAATTCGAGAAGCTGAAGCGACGCAAGAAGAACGCCGCCAAGCAAGGACCGCAAACGCATTGGTATA

Full Affymetrix probeset data:

Annotations for 1637951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720